Rroxscaffold_139G00452220

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000139
Physical Location & Seq
Reverse (-)
1528 .. 3201
1674 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_139G00452220.1

Sequence Viewer

Length: 159 bp
ATGATTAACAGGGACAGTCGGGGGCATTCGTATTTCATAGTCAGAGGTGAAATTCTTGGATTTATGAAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCGGATACCGTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.22

Weight (kDa)

8.23

Isoelectric Point (pI)

33.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000295)

Species Orthologous Gene IDs
pyrus_communis pycom2132g00010
rosa_roxburghii Rroxscaffold_101G00451080 Rroxscaffold_103G00450520 Rroxscaffold_105G00447130 Rroxscaffold_105G00447170 Rroxscaffold_107G00442620 Rroxscaffold_107G00442680 Rroxscaffold_107G00442720 Rroxscaffold_109G00451490 Rroxscaffold_111G00451540 Rroxscaffold_117G00451730 Rroxscaffold_119G00451820 Rroxscaffold_124G00451940 Rroxscaffold_129G00452080 Rroxscaffold_130G00452090 Rroxscaffold_133G00452140 Rroxscaffold_137G00452170 Rroxscaffold_139G00452220 Rroxscaffold_13G00448650 Rroxscaffold_13G00448660 Rroxscaffold_144G00452230 Rroxscaffold_147G00452260 Rroxscaffold_15G00447540 Rroxscaffold_15G00447550 Rroxscaffold_15G00447560 Rroxscaffold_16G00446230 Rroxscaffold_17G00435400 Rroxscaffold_17G00435490 Rroxscaffold_17G00435550 Rroxscaffold_17G00435630 Rroxscaffold_17G00435670 Rroxscaffold_17G00435740 Rroxscaffold_17G00435750 Rroxscaffold_17G00435820 Rroxscaffold_17G00435830 Rroxscaffold_17G00435890 Rroxscaffold_17G00435900 Rroxscaffold_1G00000120 Rroxscaffold_1G00000140 Rroxscaffold_1G00000170 Rroxscaffold_20G00445080 Rroxscaffold_21G00439530 Rroxscaffold_21G00439610 Rroxscaffold_22G00439860 Rroxscaffold_22G00439960 Rroxscaffold_24G00445010 Rroxscaffold_26G00447780 Rroxscaffold_27G00446620 Rroxscaffold_27G00446630 Rroxscaffold_28G00446940 Rroxscaffold_28G00446950 Rroxscaffold_28G00446960 Rroxscaffold_29G00441540 Rroxscaffold_29G00441550 Rroxscaffold_32G00442730 Rroxscaffold_32G00442850 Rroxscaffold_33G00439730 Rroxscaffold_36G00440150 Rroxscaffold_37G00445150 Rroxscaffold_38G00444610 Rroxscaffold_38G00444640 Rroxscaffold_39G00448190 Rroxscaffold_39G00448240 Rroxscaffold_39G00448250 Rroxscaffold_40G00447690 Rroxscaffold_42G00450450 Rroxscaffold_44G00440620 Rroxscaffold_44G00440650 Rroxscaffold_45G00438830 Rroxscaffold_45G00438970 Rroxscaffold_46G00448710 Rroxscaffold_46G00448750 Rroxscaffold_47G00444030 Rroxscaffold_51G00447880 Rroxscaffold_52G00439410 Rroxscaffold_55G00450110 Rroxscaffold_56G00450960 Rroxscaffold_57G00443090 Rroxscaffold_57G00443100 Rroxscaffold_58G00448990 Rroxscaffold_58G00449030 Rroxscaffold_58G00449040 Rroxscaffold_59G00442100 Rroxscaffold_59G00442110 Rroxscaffold_59G00442120 Rroxscaffold_59G00442130 Rroxscaffold_60G00448420 Rroxscaffold_61G00449960 Rroxscaffold_61G00449980 Rroxscaffold_62G00437950 Rroxscaffold_65G00445320 Rroxscaffold_65G00445330 Rroxscaffold_67G00448110 Rroxscaffold_67G00448180 Rroxscaffold_6G00387750 Rroxscaffold_70G00446410 Rroxscaffold_73G00439300 Rroxscaffold_74G00442880 Rroxscaffold_74G00442940 Rroxscaffold_75G00447420 Rroxscaffold_76G00448560 Rroxscaffold_77G00449170 Rroxscaffold_77G00449180 Rroxscaffold_77G00449190 Rroxscaffold_77G00449200 Rroxscaffold_81G00450460 Rroxscaffold_81G00450470 Rroxscaffold_82G00450790 Rroxscaffold_82G00450800 Rroxscaffold_84G00451000 Rroxscaffold_84G00451010 Rroxscaffold_90G00448800 Rroxscaffold_91G00442990 Rroxscaffold_91G00443020 Rroxscaffold_91G00443030 Rroxscaffold_91G00443050 Rroxscaffold_92G00446530 Rroxscaffold_93G00440920 Rroxscaffold_95G00449220 Rroxscaffold_96G00449120 Rroxscaffold_96G00449130 Rroxscaffold_96G00449140 Rroxscaffold_98G00451330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 51
AjuI GAANNNNNNNTTGG 2 cut(s) 88, 120
ApoI RAATTY 1 cut(s) 51
AseI ATTAAT 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 59
BanII GRGCYC 1 cut(s) 135
BbsI GAAGAC 1 cut(s) 144
BciVI GTATCC 1 cut(s) 141
BfaI CTAG 1 cut(s) 157
BfuI GTATCC 1 cut(s) 141
BpiI GAAGAC 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 95
BseDI CCNNGG 1 cut(s) 95
BseGI GGATG 1 cut(s) 105
Bsh1285I CGRYCG 1 cut(s) 145
BsiEI CGRYCG 1 cut(s) 145
BslFI GGGAC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 26
BsmI GAATGC 1 cut(s) 25
Bsp1286I GDGCHC 1 cut(s) 135
Bsp143I GATC 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 95
BssMI GATC 1 cut(s) 142
BssT1I CCWWGG 1 cut(s) 95
Bst4CI ACNGT 2 cut(s) 17, 153
BstF5I GGATG 1 cut(s) 105
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstMCI CGRYCG 1 cut(s) 145
BstV2I GAAGAC 1 cut(s) 144
BsuI GTATCC 1 cut(s) 141
BtsCI GGATG 1 cut(s) 105
CviJI RGCY 1 cut(s) 133
CviKI_1 RGCY 1 cut(s) 133
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
Eco130I CCWWGG 1 cut(s) 95
Eco24I GRGCYC 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 95
EcoT38I GRGCYC 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 95
FaiI YATR 2 cut(s) 38, 65
FaqI GGGAC 1 cut(s) 26
FokI GGATG 1 cut(s) 112
FriOI GRGCYC 1 cut(s) 135
FspBI CTAG 1 cut(s) 157
HphI GGTGA 1 cut(s) 59
Hpy188I TCNGA 2 cut(s) 44, 147
Hpy188III TCNNGA 1 cut(s) 115
HpyCH4III ACNGT 2 cut(s) 17, 153
Kzo9I GATC 1 cut(s) 142
MaeI CTAG 1 cut(s) 157
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 1 cut(s) 149
MhlI GDGCHC 1 cut(s) 135
MluCI AATT 1 cut(s) 51
MnlI CCTC 1 cut(s) 38
MseI TTAA 2 cut(s) 6, 110
Mva1269I GAATGC 1 cut(s) 25
NdeII GATC 1 cut(s) 142
PctI GAATGC 1 cut(s) 25
Ple19I CGATCG 1 cut(s) 145
PshBI ATTAAT 1 cut(s) 110
PvuI CGATCG 1 cut(s) 145
SaqAI TTAA 2 cut(s) 6, 110
Sau3AI GATC 1 cut(s) 142
SduI GDGCHC 1 cut(s) 135
SetI ASST 1 cut(s) 49
SgeI CNNG 6 cut(s) 22, 32, 68, 108, 127, 146
Sse9I AATT 1 cut(s) 51
SspMI CTAG 1 cut(s) 157
StyI CCWWGG 1 cut(s) 95
TaaI ACNGT 2 cut(s) 17, 153
TaqI TCGA 1 cut(s) 135
TasI AATT 1 cut(s) 51
Tru1I TTAA 2 cut(s) 6, 110
Tru9I TTAA 2 cut(s) 6, 110
TspDTI ATGAA 3 cut(s) 25, 80, 96
VspI ATTAAT 1 cut(s) 110
XapI RAATTY 1 cut(s) 51
XspI CTAG 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.