Rroxscaffold_1G00031610

Non-specific lipid transfer protein GPI-anchored

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
44790028 .. 44792382
2355 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00031610.1

Sequence Viewer

Length: 171 bp
ATGGCTTCTGAAGGGTCTACTGCTAACTCACCTGCTGGTTCGGAGCTAGCACCTCAAGGACCTTCTGCTTCCTCAGGAAACCAAACAAACCTTGGAGCTTCAACTACTGCTAAATCCCTTATGGCACTCTTTATTGGCTTAGCTATAGCATCTCTTCCTACATTTTTCTGA

Protein Analysis

56

Amino Acids

5.43

Weight (kDa)

4.53

Isoelectric Point (pI)

44.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012027)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 40
Acc36I ACCTGC 1 cut(s) 40
AccI GTMKAC 1 cut(s) 17
AcuI CTGAAG 1 cut(s) 30
AgsI TTSAA 1 cut(s) 102
AluBI AGCT 3 cut(s) 46, 98, 143
AluI AGCT 3 cut(s) 46, 98, 143
AspS9I GGNCC 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 21
AsuNHI GCTAGC 1 cut(s) 46
AvaII GGWCC 1 cut(s) 59
AxyI CCTNAGG 1 cut(s) 73
BfaI CTAG 1 cut(s) 47
BfmI CTRYAG 1 cut(s) 144
BfuAI ACCTGC 1 cut(s) 40
BlpI GCTNAGC 1 cut(s) 139
Bme18I GGWCC 1 cut(s) 59
BmgT120I GGNCC 1 cut(s) 59
BmsI GCATC 1 cut(s) 158
BmtI GCTAGC 1 cut(s) 50
Bpu1102I GCTNAGC 1 cut(s) 139
BpuEI CTTGAG 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 91
Bse21I CCTNAGG 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 91
BseMII CTCAG 1 cut(s) 87
Bsp1720I GCTNAGC 1 cut(s) 139
BspCNI CTCAG 1 cut(s) 86
BspMI ACCTGC 1 cut(s) 40
BspOI GCTAGC 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 91
BssT1I CCWWGG 1 cut(s) 91
Bst6I CTCTTC 1 cut(s) 159
BstC8I GCNNGC 1 cut(s) 48
BstDEI CTNAG 2 cut(s) 73, 139
BstSFI CTRYAG 1 cut(s) 144
Bsu36I CCTNAGG 1 cut(s) 73
BveI ACCTGC 1 cut(s) 40
Cac8I GCNNGC 1 cut(s) 48
Cfr13I GGNCC 1 cut(s) 59
CviJI RGCY 5 cut(s) 5, 46, 98, 138, 143
CviKI_1 RGCY 5 cut(s) 5, 46, 98, 138, 143
DdeI CTNAG 2 cut(s) 73, 139
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 59
Eco57I CTGAAG 1 cut(s) 30
Eco81I CCTNAGG 1 cut(s) 73
EcoO109I RGGNCCY 1 cut(s) 59
EcoT14I CCWWGG 1 cut(s) 91
ErhI CCWWGG 1 cut(s) 91
FaiI YATR 2 cut(s) 122, 146
FblI GTMKAC 1 cut(s) 17
FspBI CTAG 1 cut(s) 47
HphI GGTGA 1 cut(s) 21
Hpy166II GTNNAC 1 cut(s) 18
Hpy188I TCNGA 3 cut(s) 10, 43, 170
Hpy188III TCNNGA 1 cut(s) 75
Hpy8I GTNNAC 1 cut(s) 18
HpyAV CCTTC 2 cut(s) 5, 72
HpyF3I CTNAG 2 cut(s) 73, 139
LmnI GCTCC 2 cut(s) 43, 95
LpnPI CCDG 3 cut(s) 21, 45, 60
LweI GCATC 1 cut(s) 158
MaeI CTAG 1 cut(s) 47
MboII GAAGA 1 cut(s) 146
MnlI CCTC 2 cut(s) 63, 82
NheI GCTAGC 1 cut(s) 46
PaqCI CACCTGC 1 cut(s) 40
PpuMI RGGWCCY 1 cut(s) 59
Psp5II RGGWCCY 1 cut(s) 59
PspPI GGNCC 1 cut(s) 59
PspPPI RGGWCCY 1 cut(s) 59
Sau96I GGNCC 1 cut(s) 59
SetI ASST 7 cut(s) 34, 48, 55, 64, 93, 100, 145
SfaNI GCATC 1 cut(s) 158
SfcI CTRYAG 1 cut(s) 144
SgeI CNNG 6 cut(s) 44, 48, 59, 68, 87, 104
SinI GGWCC 1 cut(s) 59
SmlI CTYRAG 1 cut(s) 54
SmoI CTYRAG 1 cut(s) 54
SspMI CTAG 1 cut(s) 47
StyI CCWWGG 1 cut(s) 91
VpaK11BI GGWCC 1 cut(s) 59
XcmI CCANNNNNNNNNTGG 1 cut(s) 89
XmiI GTMKAC 1 cut(s) 17
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.