Rroxscaffold_2G00120180

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0017862
Physical Location & Seq
Reverse (-)
52302968 .. 52305044
2077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00120180.1

Sequence Viewer

Length: 285 bp
ATGTCGATAACGCCCAAAGACGATGCCGATACCATACACTTGAGGTATCGGGTAGGCCGCACCAAGTCCCACATTATAAATAAAGGGGTGACAAGCCCATTCCCACACTATAAATACATGTCTCTCCACTCATTCAAGGCGAGTGTAAAGATCAAGCCATTTGATGTGGAGAGCAGATCACAAACGGGGTATGTTGATTTTGGTCGAGTTGACAAGTTCAACCACTTTATTTCTGGTTCGGGGCAGGTAGACTTTGTTCAAGTGTTTTACAATGGTGATCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.8

Weight (kDa)

9.64

Isoelectric Point (pI)

39.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 77
Acc36I ACCTGC 1 cut(s) 235
AccI GTMKAC 1 cut(s) 249
AciI CCGC 1 cut(s) 58
AflIII ACRYGT 1 cut(s) 117
AgsI TTSAA 3 cut(s) 136, 220, 260
Alw26I GTCTC 1 cut(s) 126
AoxI GGCC 1 cut(s) 55
AsuHPI GGTGA 1 cut(s) 100
BcoDI GTCTC 1 cut(s) 126
BfuAI ACCTGC 1 cut(s) 235
BisI GCNGC 1 cut(s) 58
BlsI GCNGC 1 cut(s) 59
BmsI GCATC 1 cut(s) 13
BpuEI CTTGAG 1 cut(s) 61
BshFI GGCC 1 cut(s) 57
BslFI GGGAC 1 cut(s) 52
BsmAI GTCTC 1 cut(s) 126
BsmFI GGGAC 1 cut(s) 52
BsnI GGCC 1 cut(s) 57
Bsp143I GATC 3 cut(s) 150, 176, 277
BspACI CCGC 1 cut(s) 58
BspANI GGCC 1 cut(s) 57
BspMI ACCTGC 1 cut(s) 235
BssMI GATC 3 cut(s) 150, 176, 277
BstKTI GATC 3 cut(s) 153, 179, 280
BstMAI GTCTC 1 cut(s) 126
BstMBI GATC 3 cut(s) 150, 176, 277
BstNSI RCATGY 1 cut(s) 121
BsuRI GGCC 1 cut(s) 57
BveI ACCTGC 1 cut(s) 235
CviAII CATG 1 cut(s) 118
CviJI RGCY 3 cut(s) 57, 96, 157
CviKI_1 RGCY 3 cut(s) 57, 96, 157
DpnI GATC 3 cut(s) 152, 178, 279
DpnII GATC 3 cut(s) 150, 176, 277
FaeI CATG 1 cut(s) 121
FaiI YATR 5 cut(s) 35, 77, 111, 119, 192
FaqI GGGAC 1 cut(s) 52
FatI CATG 1 cut(s) 117
FblI GTMKAC 1 cut(s) 249
Fnu4HI GCNGC 1 cut(s) 58
Fsp4HI GCNGC 1 cut(s) 58
GluI GCNGC 1 cut(s) 58
HaeIII GGCC 1 cut(s) 57
Hin1II CATG 1 cut(s) 121
HincII GTYRAC 1 cut(s) 211
HindII GTYRAC 1 cut(s) 211
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 2 cut(s) 211, 250
Hpy8I GTNNAC 2 cut(s) 211, 250
Hsp92II CATG 1 cut(s) 121
Kzo9I GATC 3 cut(s) 150, 176, 277
LpnPI CCDG 2 cut(s) 219, 230
LweI GCATC 1 cut(s) 13
MaeIII GTNAC 1 cut(s) 88
MalI GATC 3 cut(s) 152, 178, 279
MboI GATC 3 cut(s) 150, 176, 277
MnlI CCTC 1 cut(s) 36
NdeII GATC 3 cut(s) 150, 176, 277
NlaIII CATG 1 cut(s) 121
NmuCI GTSAC 1 cut(s) 88
NspI RCATGY 1 cut(s) 121
PciI ACATGT 1 cut(s) 117
PkrI GCNGC 1 cut(s) 59
PscI ACATGT 1 cut(s) 117
PsiI TTATAA 1 cut(s) 77
PsrI GAACNNNNNNTAC 2 cut(s) 240, 272
SatI GCNGC 1 cut(s) 58
Sau3AI GATC 3 cut(s) 150, 176, 277
SetI ASST 2 cut(s) 47, 249
SfaNI GCATC 1 cut(s) 13
SmlI CTYRAG 1 cut(s) 40
SmoI CTYRAG 1 cut(s) 40
SsiI CCGC 1 cut(s) 58
TaqI TCGA 2 cut(s) 5, 205
TauI GCSGC 1 cut(s) 60
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
XceI RCATGY 1 cut(s) 121
XcmI CCANNNNNNNNNTGG 1 cut(s) 230
XmiI GTMKAC 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.