Rroxscaffold_2G00121980

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
54803293 .. 54803682
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00121980.1

Sequence Viewer

Length: 390 bp
ATGGAGGACCAACATGGTGGTGGAGGTGGAGGTGGATTTAGCGGCGGAGCTTCATTCATATGGATTGTTTCTTGCTCTTTATTCCTATCTATAATGGTCGGCGGCGGGTGTCTTTTGATGTATATTATCGTTCCTCATGAGCCAGGAACCATGTCCTGGCTTGCTATTACTGGAGTTGGATTGGTTTGCCTTCCATGGATGTTTTGGTTCTTCACATTCATATATCGTGTCATTACTCGGATGCGCAGAGATAACTCTAATTCTGATGGAGTTGTGACAATTGCAAATGTTAATAGAGCTAGTTCTATTGGTTCTATTGGTGGAAAGAATAATACTAACGCTGCAAATACATCTACGCCTACGGAGTCGAAGACTTACTCTGCTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

13.72

Weight (kDa)

6.71

Isoelectric Point (pI)

37.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 245
AccB7I CCANNNNNTGG 1 cut(s) 156
AciI CCGC 4 cut(s) 42, 45, 102, 105
AfiI CCNNNNNNNGG 1 cut(s) 156
AjnI CCWGG 2 cut(s) 142, 155
AluBI AGCT 2 cut(s) 50, 299
AluI AGCT 2 cut(s) 50, 299
ApeKI GCWGC 1 cut(s) 341
AspLEI GCGC 1 cut(s) 246
AspS9I GGNCC 1 cut(s) 7
AvaII GGWCC 1 cut(s) 7
BbsI GAAGAC 1 cut(s) 377
BbvI GCAGC 1 cut(s) 328
BccI CCATC 1 cut(s) 260
BciT130I CCWGG 2 cut(s) 144, 157
BfaI CTAG 1 cut(s) 300
BisI GCNGC 3 cut(s) 43, 103, 342
BlsI GCNGC 3 cut(s) 44, 104, 343
Bme1390I CCNGG 2 cut(s) 144, 157
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BmiI GGNNCC 1 cut(s) 148
BmrFI CCNGG 2 cut(s) 144, 157
BmsI GCATC 1 cut(s) 231
BpiI GAAGAC 1 cut(s) 377
BpmI CTGGAG 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 194
Bsc4I CCNNNNNNNGG 1 cut(s) 156
Bse1I ACTGG 1 cut(s) 175
BseBI CCWGG 2 cut(s) 144, 157
BseDI CCNNGG 1 cut(s) 194
BseGI GGATG 2 cut(s) 204, 246
BseLI CCNNNNNNNGG 1 cut(s) 156
BseNI ACTGG 1 cut(s) 175
BseXI GCAGC 1 cut(s) 328
BslI CCNNNNNNNGG 1 cut(s) 156
Bsp19I CCATGG 1 cut(s) 194
BspACI CCGC 4 cut(s) 42, 45, 102, 105
BspHI TCATGA 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 148
BsrI ACTGG 1 cut(s) 175
BssECI CCNNGG 1 cut(s) 194
BssT1I CCWWGG 1 cut(s) 194
Bst2UI CCWGG 2 cut(s) 144, 157
BstC8I GCNNGC 1 cut(s) 162
BstDSI CCRYGG 1 cut(s) 194
BstF5I GGATG 2 cut(s) 204, 246
BstHHI GCGC 1 cut(s) 246
BstNI CCWGG 2 cut(s) 144, 157
BstSCI CCNGG 2 cut(s) 142, 155
BstV1I GCAGC 1 cut(s) 328
BstV2I GAAGAC 1 cut(s) 377
BstXI CCANNNNNNTGG 1 cut(s) 17
BtgI CCRYGG 1 cut(s) 194
BtsCI GGATG 2 cut(s) 204, 246
Cac8I GCNNGC 1 cut(s) 162
CciI TCATGA 1 cut(s) 136
CfoI GCGC 1 cut(s) 246
Cfr13I GGNCC 1 cut(s) 7
CviAII CATG 4 cut(s) 14, 137, 151, 195
CviJI RGCY 4 cut(s) 50, 142, 160, 299
CviKI_1 RGCY 4 cut(s) 50, 142, 160, 299
EciI GGCGGA 1 cut(s) 60
Eco130I CCWWGG 1 cut(s) 194
Eco47I GGWCC 1 cut(s) 7
EcoRII CCWGG 2 cut(s) 142, 155
EcoT14I CCWWGG 1 cut(s) 194
ErhI CCWWGG 1 cut(s) 194
FaeI CATG 4 cut(s) 17, 140, 154, 198
FatI CATG 4 cut(s) 13, 136, 150, 194
FauI CCCGC 1 cut(s) 98
FauNDI CATATG 1 cut(s) 59
Fnu4HI GCNGC 3 cut(s) 43, 103, 342
FokI GGATG 2 cut(s) 211, 253
Fsp4HI GCNGC 3 cut(s) 43, 103, 342
FspBI CTAG 1 cut(s) 300
FspI TGCGCA 1 cut(s) 245
GlaI GCGC 1 cut(s) 245
GluI GCNGC 3 cut(s) 43, 103, 342
GsuI CTGGAG 1 cut(s) 192
HhaI GCGC 1 cut(s) 246
Hin1II CATG 4 cut(s) 17, 140, 154, 198
Hin6I GCGC 1 cut(s) 244
HinP1I GCGC 1 cut(s) 244
HinfI GANTC 1 cut(s) 365
Hpy188I TCNGA 2 cut(s) 240, 265
Hpy188III TCNNGA 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 200
HpyCH4V TGCA 2 cut(s) 284, 344
Hsp92II CATG 4 cut(s) 17, 140, 154, 198
HspAI GCGC 1 cut(s) 244
LmnI GCTCC 1 cut(s) 47
LpnPI CCDG 5 cut(s) 129, 142, 156, 156, 169
Lsp1109I GCAGC 1 cut(s) 328
LweI GCATC 1 cut(s) 231
MaeI CTAG 1 cut(s) 300
MaeIII GTNAC 1 cut(s) 274
MboII GAAGA 2 cut(s) 202, 382
MfeI CAATTG 1 cut(s) 279
MluCI AATT 2 cut(s) 259, 279
MlyI GAGTC 1 cut(s) 374
MmeI TCCRAC 1 cut(s) 157
MnlI CCTC 3 cut(s) 17, 23, 144
MseI TTAA 1 cut(s) 291
MslI CAYNNNNRTG 2 cut(s) 18, 58
MspR9I CCNGG 2 cut(s) 144, 157
MunI CAATTG 1 cut(s) 279
MvaI CCWGG 2 cut(s) 144, 157
NcoI CCATGG 1 cut(s) 194
NdeI CATATG 1 cut(s) 59
NlaIII CATG 4 cut(s) 17, 140, 154, 198
NlaIV GGNNCC 1 cut(s) 148
NmuCI GTSAC 1 cut(s) 274
NsbI TGCGCA 1 cut(s) 245
PagI TCATGA 1 cut(s) 136
PflMI CCANNNNNTGG 1 cut(s) 156
PkrI GCNGC 3 cut(s) 44, 104, 343
PleI GAGTC 1 cut(s) 373
PpsI GAGTC 1 cut(s) 373
Psp6I CCWGG 2 cut(s) 142, 155
PspGI CCWGG 2 cut(s) 142, 155
PspN4I GGNNCC 1 cut(s) 148
PspPI GGNCC 1 cut(s) 7
RseI CAYNNNNRTG 2 cut(s) 18, 58
SaqAI TTAA 1 cut(s) 291
SatI GCNGC 3 cut(s) 43, 103, 342
Sau96I GGNCC 1 cut(s) 7
SchI GAGTC 1 cut(s) 374
ScrFI CCNGG 2 cut(s) 144, 157
SetI ASST 4 cut(s) 28, 34, 52, 301
SfaNI GCATC 1 cut(s) 231
SinI GGWCC 1 cut(s) 7
SmiMI CAYNNNNRTG 2 cut(s) 18, 58
Sse9I AATT 2 cut(s) 259, 279
SsiI CCGC 4 cut(s) 42, 45, 102, 105
SspMI CTAG 1 cut(s) 300
StyD4I CCNGG 2 cut(s) 142, 155
StyI CCWWGG 1 cut(s) 194
TaqI TCGA 1 cut(s) 368
TasI AATT 2 cut(s) 259, 279
TauI GCSGC 2 cut(s) 45, 105
Tru1I TTAA 1 cut(s) 291
Tru9I TTAA 1 cut(s) 291
TseFI GTSAC 1 cut(s) 274
TseI GCWGC 1 cut(s) 341
Tsp45I GTSAC 1 cut(s) 274
TspDTI ATGAA 3 cut(s) 42, 46, 208
TspGWI ACGGA 1 cut(s) 377
Van91I CCANNNNNTGG 1 cut(s) 156
VpaK11BI GGWCC 1 cut(s) 7
XcmI CCANNNNNNNNNTGG 2 cut(s) 17, 201
XspI CTAG 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.