Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0009816

Physical Location & Seq

Genomic Coordinates Forward (+)

68336413 .. 68343169

Gene Structure 6757 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00131630.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

ATGAGTTATATGAATGATAATCAAGTAGGTCCAGTTTTACGCGGTTGCAAGCAGTTTTGGAAAGCAGAGGATTATGACGGTGACAAGGAGAACGATGCTAGTCAACAACCAACAAAACTCGATGATCCTCACTACAAAAGCAATGAAAACATGCACATAATCCAAAATTATCAACGTCCAAAGTCAAATCACTTGACTAGCTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006139 GO:0006282 GO:0006355 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009889 GO:0009987 GO:0010468 GO:0010556 GO:0016462 GO:0016787 GO:0016788 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0031935 GO:0033043 GO:0033044 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0048583 GO:0050789 GO:0050794 GO:0051052 GO:0051128 GO:0051171 GO:0051252 GO:0060255 GO:0060968 GO:0065007 GO:0071704 GO:0080090 GO:0080134 GO:0080135 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363 GO:1902275 GO:1903506 GO:2000112 GO:2001020 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HATPase_c_3

Protein Analysis

67

Amino Acids

7.86

Weight (kDa)

5.8

Isoelectric Point (pI)

63.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009816)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G23430
fragaria_vesca	FvH4_1g15820 FvH4_1g15820 FvH4_1g15820
malus_domestica	MD00G1044500.v1.1 MD02G1170300.v1.1
prunus_persica	Prupe.7G135000_v2.0.a1 Prupe.7G135000_v2.0.a1
pyrus_communis	pycom15g24530
rosa_chinensis	RchiOBHm_Chr2g0105111
rosa_laevigata	RLG00000017404
rosa_multiflora	Rmu_sc0006734.1_g000001 Rmu_sc0023500.1_g000001
rosa_roxburghii	Rroxscaffold_2G00131630 Rroxscaffold_2G00138410
rosa_rugosa	Rorug02G0126300
rosa_samantha	Rh2AG177200 Rh2BG185200 Rh2CG181600 Rh2DG183300
rosa_wichuraiana	Rw2G013900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	42
AciI	CCGC	1 cut(s)	42
AclWI	GGATC	1 cut(s)	119
AluBI	AGCT	1 cut(s)	201
AluI	AGCT	1 cut(s)	201
AlwI	GGATC	1 cut(s)	119
AspS9I	GGNCC	1 cut(s)	29
AsuHPI	GGTGA	1 cut(s)	92
AvaII	GGWCC	1 cut(s)	29
BfaI	CTAG	2 cut(s)	99, 198
Bme18I	GGWCC	1 cut(s)	29
BmgT120I	GGNCC	1 cut(s)	29
BmsI	GCATC	1 cut(s)	85
Bse1I	ACTGG	1 cut(s)	32
Bse3DI	GCAATG	1 cut(s)	148
BseMI	GCAATG	1 cut(s)	148
BseNI	ACTGG	1 cut(s)	32
Bsh1236I	CGCG	1 cut(s)	42
Bsp143I	GATC	1 cut(s)	124
BspACI	CCGC	1 cut(s)	42
BspFNI	CGCG	1 cut(s)	42
BspPI	GGATC	1 cut(s)	119
BsrDI	GCAATG	1 cut(s)	148
BsrI	ACTGG	1 cut(s)	32
BssMI	GATC	1 cut(s)	124
Bst4CI	ACNGT	1 cut(s)	80
BstC8I	GCNNGC	1 cut(s)	50
BstFNI	CGCG	1 cut(s)	42
BstKTI	GATC	1 cut(s)	127
BstMBI	GATC	1 cut(s)	124
BstNSI	RCATGY	1 cut(s)	154
BstUI	CGCG	1 cut(s)	42
Cac8I	GCNNGC	1 cut(s)	50
Cfr13I	GGNCC	1 cut(s)	29
CviAII	CATG	1 cut(s)	151
CviJI	RGCY	1 cut(s)	201
CviKI_1	RGCY	1 cut(s)	201
DpnI	GATC	1 cut(s)	126
DpnII	GATC	1 cut(s)	124
Eco47I	GGWCC	1 cut(s)	29
FaeI	CATG	1 cut(s)	154
FaiI	YATR	5 cut(s)	9, 11, 75, 152, 158
FatI	CATG	1 cut(s)	150
FspBI	CTAG	2 cut(s)	99, 198
Hin1II	CATG	1 cut(s)	154
HincII	GTYRAC	1 cut(s)	104
HindII	GTYRAC	1 cut(s)	104
HphI	GGTGA	1 cut(s)	92
Hpy166II	GTNNAC	1 cut(s)	104
Hpy8I	GTNNAC	1 cut(s)	104
HpyCH4III	ACNGT	1 cut(s)	80
HpyCH4IV	ACGT	1 cut(s)	175
HpyCH4V	TGCA	2 cut(s)	48, 154
HpySE526I	ACGT	1 cut(s)	175
Hsp92II	CATG	1 cut(s)	154
Kzo9I	GATC	1 cut(s)	124
LpnPI	CCDG	1 cut(s)	45
LweI	GCATC	1 cut(s)	85
MaeI	CTAG	2 cut(s)	99, 198
MaeII	ACGT	1 cut(s)	175
MaeIII	GTNAC	1 cut(s)	80
MalI	GATC	1 cut(s)	126
MboI	GATC	1 cut(s)	124
MluCI	AATT	1 cut(s)	166
MnlI	CCTC	2 cut(s)	61, 138
MvnI	CGCG	1 cut(s)	42
NdeII	GATC	1 cut(s)	124
NlaIII	CATG	1 cut(s)	154
NmuCI	GTSAC	1 cut(s)	80
NspI	RCATGY	1 cut(s)	154
PspPI	GGNCC	1 cut(s)	29
Sau3AI	GATC	1 cut(s)	124
Sau96I	GGNCC	1 cut(s)	29
SetI	ASST	3 cut(s)	31, 178, 203
SfaNI	GCATC	1 cut(s)	85
SgeI	CNNG	8 cut(s)	35, 44, 53, 61, 97, 111, 131, 163
SinI	GGWCC	1 cut(s)	29
Sse9I	AATT	1 cut(s)	166
SsiI	CCGC	1 cut(s)	42
SspMI	CTAG	2 cut(s)	99, 198
TaaI	ACNGT	1 cut(s)	80
TaiI	ACGT	1 cut(s)	178
TaqI	TCGA	1 cut(s)	120
TasI	AATT	1 cut(s)	166
TseFI	GTSAC	1 cut(s)	80
Tsp45I	GTSAC	1 cut(s)	80
TspDTI	ATGAA	2 cut(s)	26, 159
VpaK11BI	GGWCC	1 cut(s)	29
XceI	RCATGY	1 cut(s)	154
XspI	CTAG	2 cut(s)	99, 198

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.