Rroxscaffold_4G00289580

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
10169791 .. 10173473
3683 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00289580.1

Sequence Viewer

Length: 249 bp
ATGCTTCTTAATGTGTCCAAACATCTGATCATCAACATTGAGAGGGGAAAGTCCTTAGTAAACCATCATTTTACTCACCCAGAATCCCTAGTCACATGGGAGATTATCAGAGCGCGCCCCAACCAAGGGAAGATGAAGAAGCGAGGCACTACATGTGATTTTTATGTCCCAGAGTTGCCAGAATATGCCTCATTGCTACCGGAAGGCTGGCTCACCGAGAAGAGGGTCATGCACCATGGGAGGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.62

Weight (kDa)

9.73

Isoelectric Point (pI)

63.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 115
AfiI CCNNNNNNNGG 3 cut(s) 125, 126, 222
AflIII ACRYGT 1 cut(s) 152
AspLEI GCGC 2 cut(s) 115, 117
AsuHPI GGTGA 2 cut(s) 68, 205
BccI CCATC 1 cut(s) 72
BclI TGATCA 1 cut(s) 27
BfaI CTAG 1 cut(s) 89
BsaJI CCNNGG 2 cut(s) 124, 235
BsaWI WCCGGW 1 cut(s) 199
Bsc4I CCNNNNNNNGG 3 cut(s) 125, 126, 222
Bse3DI GCAATG 1 cut(s) 191
BseDI CCNNGG 2 cut(s) 124, 235
BseLI CCNNNNNNNGG 3 cut(s) 125, 126, 222
BseMI GCAATG 1 cut(s) 191
BsePI GCGCGC 1 cut(s) 113
Bsh1236I CGCG 1 cut(s) 115
BsiSI CCGG 1 cut(s) 200
BslFI GGGAC 1 cut(s) 152
BslI CCNNNNNNNGG 3 cut(s) 125, 126, 222
BsmFI GGGAC 1 cut(s) 152
Bsp143I GATC 1 cut(s) 27
Bsp19I CCATGG 1 cut(s) 235
BspFNI CGCG 1 cut(s) 115
BsrDI GCAATG 1 cut(s) 191
BssECI CCNNGG 2 cut(s) 124, 235
BssHII GCGCGC 1 cut(s) 113
BssMI GATC 1 cut(s) 27
BssT1I CCWWGG 2 cut(s) 124, 235
Bst6I CTCTTC 1 cut(s) 215
BstC8I GCNNGC 2 cut(s) 115, 209
BstDEI CTNAG 1 cut(s) 55
BstDSI CCRYGG 1 cut(s) 235
BstFNI CGCG 1 cut(s) 115
BstHHI GCGC 2 cut(s) 115, 117
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BstNSI RCATGY 1 cut(s) 156
BstUI CGCG 1 cut(s) 115
BtgI CCRYGG 1 cut(s) 235
Cac8I GCNNGC 2 cut(s) 115, 209
CfoI GCGC 2 cut(s) 115, 117
CviAII CATG 4 cut(s) 96, 153, 229, 236
CviJI RGCY 2 cut(s) 207, 211
CviKI_1 RGCY 2 cut(s) 207, 211
DdeI CTNAG 1 cut(s) 55
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
Eam1104I CTCTTC 1 cut(s) 215
EarI CTCTTC 1 cut(s) 215
Eco130I CCWWGG 2 cut(s) 124, 235
EcoT14I CCWWGG 2 cut(s) 124, 235
ErhI CCWWGG 2 cut(s) 124, 235
FaeI CATG 4 cut(s) 99, 156, 232, 239
FaiI YATR 6 cut(s) 97, 154, 165, 186, 230, 237
FaqI GGGAC 1 cut(s) 152
FatI CATG 4 cut(s) 95, 152, 228, 235
FbaI TGATCA 1 cut(s) 27
FspBI CTAG 1 cut(s) 89
GlaI GCGC 2 cut(s) 114, 116
HapII CCGG 1 cut(s) 200
HhaI GCGC 2 cut(s) 115, 117
Hin1II CATG 4 cut(s) 99, 156, 232, 239
Hin6I GCGC 2 cut(s) 113, 115
HinP1I GCGC 2 cut(s) 113, 115
HinfI GANTC 1 cut(s) 83
HpaII CCGG 1 cut(s) 200
HphI GGTGA 2 cut(s) 68, 205
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 2 cut(s) 27, 110
Hpy8I GTNNAC 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 197
HpyCH4V TGCA 1 cut(s) 232
HpyF3I CTNAG 1 cut(s) 55
Hsp92II CATG 4 cut(s) 99, 156, 232, 239
HspAI GCGC 2 cut(s) 113, 115
Ksp22I TGATCA 1 cut(s) 27
Kzo9I GATC 1 cut(s) 27
LpnPI CCDG 5 cut(s) 93, 183, 192, 193, 213
MaeI CTAG 1 cut(s) 89
MaeIII GTNAC 1 cut(s) 91
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MboII GAAGA 3 cut(s) 142, 148, 232
MnlI CCTC 5 cut(s) 36, 137, 199, 216, 234
MseI TTAA 1 cut(s) 9
MspI CCGG 1 cut(s) 200
MvnI CGCG 1 cut(s) 115
NcoI CCATGG 1 cut(s) 235
NdeII GATC 1 cut(s) 27
NlaIII CATG 4 cut(s) 99, 156, 232, 239
NmuCI GTSAC 1 cut(s) 91
NspI RCATGY 1 cut(s) 156
PauI GCGCGC 1 cut(s) 113
PciI ACATGT 1 cut(s) 152
PfeI GAWTC 1 cut(s) 83
PscI ACATGT 1 cut(s) 152
PteI GCGCGC 1 cut(s) 113
SaqAI TTAA 1 cut(s) 9
Sau3AI GATC 1 cut(s) 27
SspMI CTAG 1 cut(s) 89
StyI CCWWGG 2 cut(s) 124, 235
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TseFI GTSAC 1 cut(s) 91
Tsp45I GTSAC 1 cut(s) 91
TspDTI ATGAA 1 cut(s) 149
XceI RCATGY 1 cut(s) 156
XspI CTAG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.