Rorug01G0335100

Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
45317749 .. 45321865
4117 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0335100.1

Sequence Viewer

Length: 384 bp
ATGGCTTCCACAGCCGAGGATCTAAGGAATCGTGATATCAAATTGGTCAAGGCCGATGGGCCTCAATTCGTCCAAAGAAACGATAAGCTTCATGGCACCAAGGCGGTAGAACCAAATAATGCCACTTCTCCCCATGAAGTTGAGGTGCCTTCTTTAGATCGTCTTGATCTCAATGAGAACTCCAATGGTGCCATTGAGGACTTCTCTGATGGCTCCAAGGCGGTAGAACCAAATAATGCCACTTCTCCCCATGAAGATGCTTGGCTTCGTAAATTACTTTATGGTGAAGGTAAGCGTCGCCGCACTATGAAGTGGAAAAGACTCCCACCTCCAGATTTTAGTTCCCTTCTTGAGGGCCTTCTCGATCCACCAGGAGTGTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.13

Weight (kDa)

5.61

Isoelectric Point (pI)

48.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 3 cut(s) 95, 145, 188
AciI CCGC 3 cut(s) 104, 221, 301
AclWI GGATC 2 cut(s) 27, 359
AfiI CCNNNNNNNGG 1 cut(s) 352
AjnI CCWGG 1 cut(s) 370
AluBI AGCT 1 cut(s) 88
AluI AGCT 1 cut(s) 88
AlwI GGATC 2 cut(s) 27, 359
AoxI GGCC 3 cut(s) 51, 59, 355
AspS9I GGNCC 2 cut(s) 59, 355
AsuHPI GGTGA 1 cut(s) 296
BanI GGYRCC 3 cut(s) 95, 145, 188
BccI CCATC 2 cut(s) 50, 203
BciT130I CCWGG 1 cut(s) 372
BisI GCNGC 1 cut(s) 301
BlsI GCNGC 1 cut(s) 302
Bme1390I CCNGG 1 cut(s) 372
BmgT120I GGNCC 2 cut(s) 59, 355
BmiI GGNNCC 4 cut(s) 97, 147, 190, 214
BmrFI CCNGG 1 cut(s) 372
BmsI GCATC 1 cut(s) 247
BplI GAGNNNNNCTC 2 cut(s) 188, 220
BpmI CTGGAG 1 cut(s) 315
BpuEI CTTGAG 1 cut(s) 371
BsaJI CCNNGG 3 cut(s) 15, 99, 216
Bsc4I CCNNNNNNNGG 1 cut(s) 352
BseBI CCWGG 1 cut(s) 372
BseDI CCNNGG 3 cut(s) 15, 99, 216
BseLI CCNNNNNNNGG 1 cut(s) 352
BshFI GGCC 3 cut(s) 53, 61, 357
BshNI GGYRCC 3 cut(s) 95, 145, 188
BslI CCNNNNNNNGG 1 cut(s) 352
BsnI GGCC 3 cut(s) 53, 61, 357
Bsp143I GATC 4 cut(s) 19, 157, 166, 364
BspACI CCGC 3 cut(s) 104, 221, 301
BspANI GGCC 3 cut(s) 53, 61, 357
BspLI GGNNCC 4 cut(s) 97, 147, 190, 214
BspPI GGATC 2 cut(s) 27, 359
BspT107I GGYRCC 3 cut(s) 95, 145, 188
BssECI CCNNGG 3 cut(s) 15, 99, 216
BssMI GATC 4 cut(s) 19, 157, 166, 364
BssT1I CCWWGG 2 cut(s) 99, 216
Bst2UI CCWGG 1 cut(s) 372
BstDEI CTNAG 1 cut(s) 23
BstENI CCTNNNNNAGG 1 cut(s) 350
BstKTI GATC 4 cut(s) 22, 160, 169, 367
BstMBI GATC 4 cut(s) 19, 157, 166, 364
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNI CCWGG 1 cut(s) 372
BstSCI CCNGG 1 cut(s) 370
BstX2I RGATCY 1 cut(s) 19
BstYI RGATCY 1 cut(s) 19
BsuRI GGCC 3 cut(s) 53, 61, 357
Cfr13I GGNCC 2 cut(s) 59, 355
CseI GACGC 1 cut(s) 284
CviAII CATG 3 cut(s) 92, 134, 251
CviJI RGCY 8 cut(s) 5, 14, 53, 61, 88, 213, 265, 357
CviKI_1 RGCY 8 cut(s) 5, 14, 53, 61, 88, 213, 265, 357
DdeI CTNAG 1 cut(s) 23
DpnI GATC 4 cut(s) 21, 159, 168, 366
DpnII GATC 4 cut(s) 19, 157, 166, 364
Eco130I CCWWGG 2 cut(s) 99, 216
Eco32I GATATC 1 cut(s) 37
EcoNI CCTNNNNNAGG 1 cut(s) 350
EcoO109I RGGNCCY 1 cut(s) 355
EcoRII CCWGG 1 cut(s) 370
EcoRV GATATC 1 cut(s) 37
EcoT14I CCWWGG 2 cut(s) 99, 216
ErhI CCWWGG 2 cut(s) 99, 216
FaeI CATG 3 cut(s) 95, 137, 254
FaiI YATR 5 cut(s) 93, 135, 252, 282, 308
FatI CATG 3 cut(s) 91, 133, 250
Fnu4HI GCNGC 1 cut(s) 301
Fsp4HI GCNGC 1 cut(s) 301
GluI GCNGC 1 cut(s) 301
GsuI CTGGAG 1 cut(s) 315
HaeIII GGCC 3 cut(s) 53, 61, 357
HgaI GACGC 1 cut(s) 284
Hin1II CATG 3 cut(s) 95, 137, 254
HindIII AAGCTT 1 cut(s) 86
HinfI GANTC 2 cut(s) 28, 321
HphI GGTGA 1 cut(s) 296
Hpy188I TCNGA 1 cut(s) 208
Hpy188III TCNNGA 5 cut(s) 32, 164, 332, 350, 362
Hpy99I CGWCG 1 cut(s) 300
HpyAV CCTTC 4 cut(s) 159, 281, 356, 368
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 23
Hsp92II CATG 3 cut(s) 95, 137, 254
Kzo9I GATC 4 cut(s) 19, 157, 166, 364
LmnI GCTCC 1 cut(s) 218
LpnPI CCDG 2 cut(s) 345, 357
LweI GCATC 1 cut(s) 247
MalI GATC 4 cut(s) 21, 159, 168, 366
MboI GATC 4 cut(s) 19, 157, 166, 364
MboII GAAGA 1 cut(s) 266
MflI RGATCY 1 cut(s) 19
MluCI AATT 3 cut(s) 41, 65, 272
MlyI GAGTC 1 cut(s) 315
MnlI CCTC 6 cut(s) 10, 72, 136, 190, 339, 346
MslI CAYNNNNRTG 1 cut(s) 255
MspR9I CCNGG 1 cut(s) 372
MvaI CCWGG 1 cut(s) 372
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 4 cut(s) 19, 157, 166, 364
NlaIII CATG 3 cut(s) 95, 137, 254
NlaIV GGNNCC 4 cut(s) 97, 147, 190, 214
NmeAIII GCCGAG 1 cut(s) 40
PfeI GAWTC 1 cut(s) 28
PkrI GCNGC 1 cut(s) 302
PleI GAGTC 1 cut(s) 315
PpsI GAGTC 1 cut(s) 315
Psp6I CCWGG 1 cut(s) 370
PspGI CCWGG 1 cut(s) 370
PspN4I GGNNCC 4 cut(s) 97, 147, 190, 214
PspPI GGNCC 2 cut(s) 59, 355
PsuI RGATCY 1 cut(s) 19
RseI CAYNNNNRTG 1 cut(s) 255
SatI GCNGC 1 cut(s) 301
Sau3AI GATC 4 cut(s) 19, 157, 166, 364
Sau96I GGNCC 2 cut(s) 59, 355
SchI GAGTC 1 cut(s) 315
ScrFI CCNGG 1 cut(s) 372
SetI ASST 4 cut(s) 90, 147, 292, 331
SfaNI GCATC 1 cut(s) 247
SmiMI CAYNNNNRTG 1 cut(s) 255
SmlI CTYRAG 1 cut(s) 350
SmoI CTYRAG 1 cut(s) 350
Sse9I AATT 3 cut(s) 41, 65, 272
SsiI CCGC 3 cut(s) 104, 221, 301
StyD4I CCNGG 1 cut(s) 370
StyI CCWWGG 2 cut(s) 99, 216
TaqI TCGA 1 cut(s) 363
TasI AATT 3 cut(s) 41, 65, 272
TauI GCSGC 1 cut(s) 303
TfiI GAWTC 1 cut(s) 28
TspDTI ATGAA 4 cut(s) 80, 150, 267, 323
XagI CCTNNNNNAGG 1 cut(s) 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.