Rmu_sc0000079.1_g000002

Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000079.1
Physical Location & Seq
Reverse (-)
5649 .. 7969
2321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000079.1_g000002.1.cds

Sequence Viewer

Length: 594 bp
ctgccatctgatcatgctccagattcactgagcacagctgatcttcaacccttgatcctccactccacacacaaaatcgtccctcaaggcgggtatgaggatgatcaagaggaggaggagattccaaaaccacgaaggatcggccgatacgtcgccggaaaagtgaactttcgaccgggtcccgatcgcgtcgactgtagttgctccgatcttcattattcgtcaccggaggtggccggaagtgagagaaccagtcgggtcgggtcaccgggtttgggtcggagggttaacgtcgtctactataatgaagcaagcggcgggaggggtgttccactcaccgtcctcatggatttggagcctgggaccgtggacagcgtcagatctggacagatcttccgtcccgataactttgtcttcaatcaatctgatgctagaaacaactgggcgaaaggtcactacaccgaggtggctgatttgatcgattcagttctcgatgtgatgctaacagaggtggagaactgtgactgcttgcaagggttccaggtatgccattcttgggtggtggtgctagatctggaatgggaacacttatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

197

Amino Acids

21.86

Weight (kDa)

4.76

Isoelectric Point (pI)

53.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 192, 297
AccII CGCG 1 cut(s) 189
AciI CCGC 3 cut(s) 90, 315, 318
AclWI GGATC 2 cut(s) 49, 146
AcoI YGGCCR 2 cut(s) 142, 234
AfiI CCNNNNNNNGG 3 cut(s) 89, 275, 556
AgsI TTSAA 2 cut(s) 47, 418
AjnI CCWGG 2 cut(s) 358, 540
AleI CACNNNNGTG 1 cut(s) 464
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
Alw21I GWGCWC 1 cut(s) 35
AlwI GGATC 2 cut(s) 49, 146
AoxI GGCC 2 cut(s) 142, 234
AspS9I GGNCC 2 cut(s) 179, 363
AsuC2I CCSGG 2 cut(s) 177, 270
AsuHPI GGTGA 3 cut(s) 216, 258, 328
AvaII GGWCC 2 cut(s) 179, 363
BbsI GAAGAC 1 cut(s) 406
Bbv12I GWGCWC 1 cut(s) 35
BccI CCATC 1 cut(s) 13
BciT130I CCWGG 2 cut(s) 360, 542
BclI TGATCA 2 cut(s) 10, 103
BcnI CCSGG 2 cut(s) 177, 270
BfaI CTAG 2 cut(s) 432, 569
BfmI CTRYAG 1 cut(s) 196
BglII AGATCT 3 cut(s) 380, 390, 571
BisI GCNGC 1 cut(s) 316
BlsI GCNGC 1 cut(s) 317
Bme1390I CCNGG 4 cut(s) 177, 270, 360, 542
Bme18I GGWCC 2 cut(s) 179, 363
BmgT120I GGNCC 2 cut(s) 179, 363
BmiI GGNNCC 5 cut(s) 180, 181, 357, 364, 539
BmrFI CCNGG 4 cut(s) 177, 270, 360, 542
BmrI ACTGGG 1 cut(s) 451
BmsI GCATC 2 cut(s) 418, 489
BmuI ACTGGG 1 cut(s) 451
BpiI GAAGAC 1 cut(s) 406
BpuEI CTTGAG 1 cut(s) 69
BpuMI CCSGG 2 cut(s) 177, 270
Bsa29I ATCGAT 1 cut(s) 480
BsaJI CCNNGG 3 cut(s) 359, 366, 462
BsaWI WCCGGW 1 cut(s) 226
Bsc4I CCNNNNNNNGG 3 cut(s) 89, 275, 556
Bse1I ACTGG 2 cut(s) 252, 446
BseBI CCWGG 2 cut(s) 360, 542
BseCI ATCGAT 1 cut(s) 480
BseDI CCNNGG 3 cut(s) 359, 366, 462
BseGI GGATG 1 cut(s) 106
BseLI CCNNNNNNNGG 3 cut(s) 89, 275, 556
BseMII CTCAG 1 cut(s) 20
BseNI ACTGG 2 cut(s) 252, 446
BseRI GAGGAG 3 cut(s) 125, 128, 131
BseX3I CGGCCG 1 cut(s) 142
Bsh1236I CGCG 1 cut(s) 189
Bsh1285I CGRYCG 3 cut(s) 145, 176, 187
BshFI GGCC 2 cut(s) 144, 236
BshVI ATCGAT 1 cut(s) 480
BsiEI CGRYCG 3 cut(s) 145, 176, 187
BsiHKAI GWGCWC 1 cut(s) 35
BsiSI CCGG 5 cut(s) 156, 176, 227, 237, 269
BslFI GGGAC 4 cut(s) 65, 165, 376, 384
BslI CCNNNNNNNGG 3 cut(s) 89, 275, 556
BsmFI GGGAC 4 cut(s) 65, 165, 376, 384
BsnI GGCC 2 cut(s) 144, 236
Bsp1286I GDGCHC 1 cut(s) 35
BspACI CCGC 3 cut(s) 90, 315, 318
BspANI GGCC 2 cut(s) 144, 236
BspCNI CTCAG 1 cut(s) 21
BspDI ATCGAT 1 cut(s) 480
BspFNI CGCG 1 cut(s) 189
BspLI GGNNCC 5 cut(s) 180, 181, 357, 364, 539
BspPI GGATC 2 cut(s) 49, 146
BsrI ACTGG 2 cut(s) 252, 446
BssECI CCNNGG 3 cut(s) 359, 366, 462
Bst2UI CCWGG 2 cut(s) 360, 542
Bst4CI ACNGT 4 cut(s) 197, 340, 367, 521
BstC8I GCNNGC 2 cut(s) 313, 530
BstDEI CTNAG 1 cut(s) 29
BstDSI CCRYGG 1 cut(s) 366
BstEII GGTNACC 1 cut(s) 264
BstF5I GGATG 1 cut(s) 106
BstFNI CGCG 1 cut(s) 189
BstMCI CGRYCG 3 cut(s) 145, 176, 187
BstNI CCWGG 2 cut(s) 360, 542
BstPI GGTNACC 1 cut(s) 264
BstSCI CCNGG 4 cut(s) 175, 268, 358, 540
BstSFI CTRYAG 1 cut(s) 196
BstUI CGCG 1 cut(s) 189
BstV2I GAAGAC 1 cut(s) 406
BstX2I RGATCY 3 cut(s) 380, 390, 571
BstYI RGATCY 3 cut(s) 380, 390, 571
BstZI CGGCCG 1 cut(s) 142
Bsu15I ATCGAT 1 cut(s) 480
BsuRI GGCC 2 cut(s) 144, 236
BsuTUI ATCGAT 1 cut(s) 480
BtgI CCRYGG 1 cut(s) 366
BtsCI GGATG 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 26
Cac8I GCNNGC 2 cut(s) 313, 530
Cfr13I GGNCC 2 cut(s) 179, 363
ClaI ATCGAT 1 cut(s) 480
CseI GACGC 2 cut(s) 178, 364
CviAII CATG 2 cut(s) 14, 346
CviJI RGCY 5 cut(s) 38, 144, 236, 358, 470
CviKI_1 RGCY 5 cut(s) 38, 144, 236, 358, 470
DdeI CTNAG 1 cut(s) 29
EaeI YGGCCR 2 cut(s) 142, 234
EagI CGGCCG 1 cut(s) 142
EclXI CGGCCG 1 cut(s) 142
Eco47I GGWCC 2 cut(s) 179, 363
Eco52I CGGCCG 1 cut(s) 142
Eco91I GGTNACC 1 cut(s) 264
EcoO109I RGGNCCY 1 cut(s) 179
EcoO65I GGTNACC 1 cut(s) 264
EcoRII CCWGG 2 cut(s) 358, 540
FaeI CATG 2 cut(s) 17, 349
FaiI YATR 6 cut(s) 15, 96, 303, 347, 547, 592
FaqI GGGAC 4 cut(s) 65, 165, 376, 384
FatI CATG 2 cut(s) 13, 345
FauI CCCGC 2 cut(s) 83, 311
FbaI TGATCA 2 cut(s) 10, 103
FblI GTMKAC 2 cut(s) 192, 297
Fnu4HI GCNGC 1 cut(s) 316
FokI GGATG 1 cut(s) 113
Fsp4HI GCNGC 1 cut(s) 316
FspBI CTAG 2 cut(s) 432, 569
GluI GCNGC 1 cut(s) 316
HaeIII GGCC 2 cut(s) 144, 236
HapII CCGG 5 cut(s) 156, 176, 227, 237, 269
HgaI GACGC 2 cut(s) 178, 364
Hin1II CATG 2 cut(s) 17, 349
HincII GTYRAC 2 cut(s) 193, 289
HindII GTYRAC 2 cut(s) 193, 289
HinfI GANTC 3 cut(s) 23, 121, 482
HpaI GTTAAC 1 cut(s) 289
HpaII CCGG 5 cut(s) 156, 176, 227, 237, 269
HphI GGTGA 3 cut(s) 216, 258, 328
Hpy166II GTNNAC 5 cut(s) 166, 193, 289, 298, 370
Hpy188I TCNGA 5 cut(s) 10, 208, 282, 380, 427
Hpy188III TCNNGA 7 cut(s) 20, 107, 182, 384, 401, 491, 575
Hpy8I GTNNAC 5 cut(s) 166, 193, 289, 298, 370
Hpy99I CGWCG 3 cut(s) 155, 194, 296
HpyAV CCTTC 1 cut(s) 129
HpyCH4III ACNGT 4 cut(s) 197, 340, 367, 521
HpyCH4IV ACGT 2 cut(s) 150, 291
HpyCH4V TGCA 1 cut(s) 532
HpyF3I CTNAG 1 cut(s) 29
HpySE526I ACGT 2 cut(s) 150, 291
Hsp92II CATG 2 cut(s) 17, 349
KflI GGGWCCC 1 cut(s) 179
Ksp22I TGATCA 2 cut(s) 10, 103
KspAI GTTAAC 1 cut(s) 289
LmnI GCTCC 3 cut(s) 22, 209, 355
LweI GCATC 2 cut(s) 418, 489
MaeI CTAG 2 cut(s) 432, 569
MaeII ACGT 2 cut(s) 150, 291
MaeIII GTNAC 4 cut(s) 222, 264, 452, 521
MboII GAAGA 4 cut(s) 35, 203, 385, 406
MflI RGATCY 3 cut(s) 380, 390, 571
MhlI GDGCHC 1 cut(s) 35
MmeI TCCRAC 1 cut(s) 260
MseI TTAA 1 cut(s) 288
MslI CAYNNNNRTG 1 cut(s) 464
MspA1I CMGCKG 1 cut(s) 38
MspI CCGG 5 cut(s) 156, 176, 227, 237, 269
MspR9I CCNGG 4 cut(s) 177, 270, 360, 542
MvaI CCWGG 2 cut(s) 360, 542
MvnI CGCG 1 cut(s) 189
NciI CCSGG 2 cut(s) 177, 270
NlaIII CATG 2 cut(s) 17, 349
NlaIV GGNNCC 5 cut(s) 180, 181, 357, 364, 539
NmuCI GTSAC 4 cut(s) 222, 264, 452, 521
OliI CACNNNNGTG 1 cut(s) 464
PcsI WCGNNNNNNNCGW 1 cut(s) 147
PfeI GAWTC 3 cut(s) 23, 121, 482
PflFI GACNNNGTC 2 cut(s) 177, 374
PkrI GCNGC 1 cut(s) 317
Ple19I CGATCG 1 cut(s) 187
PpuMI RGGWCCY 1 cut(s) 179
Psp5II RGGWCCY 1 cut(s) 179
Psp6I CCWGG 2 cut(s) 358, 540
PspEI GGTNACC 1 cut(s) 264
PspGI CCWGG 2 cut(s) 358, 540
PspN4I GGNNCC 5 cut(s) 180, 181, 357, 364, 539
PspPI GGNCC 2 cut(s) 179, 363
PspPPI RGGWCCY 1 cut(s) 179
PsuI RGATCY 3 cut(s) 380, 390, 571
PsyI GACNNNGTC 2 cut(s) 177, 374
PvuI CGATCG 1 cut(s) 187
PvuII CAGCTG 1 cut(s) 38
RseI CAYNNNNRTG 1 cut(s) 464
SalI GTCGAC 1 cut(s) 191
SaqAI TTAA 1 cut(s) 288
SatI GCNGC 1 cut(s) 316
Sau96I GGNCC 2 cut(s) 179, 363
ScrFI CCNGG 4 cut(s) 177, 270, 360, 542
SduI GDGCHC 1 cut(s) 35
SetI ASST 8 cut(s) 40, 153, 234, 294, 454, 468, 513, 546
SfaNI GCATC 2 cut(s) 418, 489
SfcI CTRYAG 1 cut(s) 196
SinI GGWCC 2 cut(s) 179, 363
SmiMI CAYNNNNRTG 1 cut(s) 464
SmlI CTYRAG 1 cut(s) 84
SmoI CTYRAG 1 cut(s) 84
SsiI CCGC 3 cut(s) 90, 315, 318
SspMI CTAG 2 cut(s) 432, 569
StyD4I CCNGG 4 cut(s) 175, 268, 358, 540
TaaI ACNGT 4 cut(s) 197, 340, 367, 521
TaiI ACGT 2 cut(s) 153, 294
TaqI TCGA 4 cut(s) 172, 192, 480, 492
TauI GCSGC 1 cut(s) 318
TfiI GAWTC 3 cut(s) 23, 121, 482
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TscAI CASTG 1 cut(s) 33
TseFI GTSAC 4 cut(s) 222, 264, 452, 521
Tsp45I GTSAC 4 cut(s) 222, 264, 452, 521
TspDTI ATGAA 2 cut(s) 203, 321
TspGWI ACGGA 1 cut(s) 386
TspRI CASTG 1 cut(s) 33
Tth111I GACNNNGTC 2 cut(s) 177, 374
VpaK11BI GGWCC 2 cut(s) 179, 363
XmiI GTMKAC 2 cut(s) 192, 297
XspI CTAG 2 cut(s) 432, 569
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.