RchiOBHm_Chr2g0121521

Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0008935
Physical Location & Seq
Forward (+)
34441414 .. 34441620
207 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49403

Sequence Viewer

Length: 207 bp
ATGGATTTGGAGCCTGGGACTGTGGACATAGTCAGATCTGGACAGATCTTCCATCCCGATAACTTTGTCTTCAGTCAATCTGGTGCTAGAAATAACTGGGCGAAAGGTCACTACACCGAGGGGGCTGATTTGATCGATTCAGTTCTCGATGTGATGCTAATAGAGGTGGAGAACTGTGACTGCTTGCAAGGTATGAATCTAGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005856 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko04145 ko04540 ko05130 map04145 map04540 map05130
Pfam Domains
Protein Families
Tubulin Tubulin_C

Protein Analysis

68

Amino Acids

7.53

Weight (kDa)

4.14

Isoelectric Point (pI)

40.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tubulin PF00091 1 - 67 1e-11 Tubulin/FtsZ family, GTPase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 55
AjnI CCWGG 1 cut(s) 13
BbsI GAAGAC 1 cut(s) 61
BccI CCATC 1 cut(s) 60
BciT130I CCWGG 1 cut(s) 15
BfaI CTAG 2 cut(s) 87, 200
BglII AGATCT 2 cut(s) 35, 45
Bme1390I CCNGG 1 cut(s) 15
BmiI GGNNCC 1 cut(s) 12
BmrFI CCNGG 1 cut(s) 15
BmrI ACTGGG 1 cut(s) 106
BmsI GCATC 1 cut(s) 144
BmuI ACTGGG 1 cut(s) 106
BpiI GAAGAC 1 cut(s) 61
Bsa29I ATCGAT 1 cut(s) 135
BsaJI CCNNGG 2 cut(s) 14, 117
Bse1I ACTGG 1 cut(s) 101
BseBI CCWGG 1 cut(s) 15
BseCI ATCGAT 1 cut(s) 135
BseDI CCNNGG 2 cut(s) 14, 117
BseGI GGATG 1 cut(s) 52
BseNI ACTGG 1 cut(s) 101
BshVI ATCGAT 1 cut(s) 135
BslFI GGGAC 1 cut(s) 31
BsmFI GGGAC 1 cut(s) 31
Bsp143I GATC 3 cut(s) 35, 45, 132
BspDI ATCGAT 1 cut(s) 135
BspLI GGNNCC 1 cut(s) 12
BsrI ACTGG 1 cut(s) 101
BssECI CCNNGG 2 cut(s) 14, 117
BssMI GATC 3 cut(s) 35, 45, 132
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 2 cut(s) 22, 176
BstC8I GCNNGC 1 cut(s) 185
BstF5I GGATG 1 cut(s) 52
BstKTI GATC 3 cut(s) 38, 48, 135
BstMBI GATC 3 cut(s) 35, 45, 132
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstV2I GAAGAC 1 cut(s) 61
BstX2I RGATCY 2 cut(s) 35, 45
BstYI RGATCY 2 cut(s) 35, 45
Bsu15I ATCGAT 1 cut(s) 135
BsuTUI ATCGAT 1 cut(s) 135
BtsCI GGATG 1 cut(s) 52
Cac8I GCNNGC 1 cut(s) 185
ClaI ATCGAT 1 cut(s) 135
CviJI RGCY 2 cut(s) 13, 125
CviKI_1 RGCY 2 cut(s) 13, 125
DpnI GATC 3 cut(s) 37, 47, 134
DpnII GATC 3 cut(s) 35, 45, 132
Eco57I CTGAAG 1 cut(s) 55
EcoRII CCWGG 1 cut(s) 13
FaiI YATR 2 cut(s) 29, 194
FaqI GGGAC 1 cut(s) 31
FokI GGATG 1 cut(s) 39
FspBI CTAG 2 cut(s) 87, 200
HinfI GANTC 2 cut(s) 137, 196
Hpy166II GTNNAC 1 cut(s) 25
Hpy188I TCNGA 1 cut(s) 35
Hpy188III TCNNGA 3 cut(s) 39, 56, 146
Hpy8I GTNNAC 1 cut(s) 25
HpyCH4III ACNGT 2 cut(s) 22, 176
HpyCH4V TGCA 1 cut(s) 187
Kzo9I GATC 3 cut(s) 35, 45, 132
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 4 cut(s) 24, 27, 66, 82
LweI GCATC 1 cut(s) 144
MaeI CTAG 2 cut(s) 87, 200
MaeIII GTNAC 2 cut(s) 107, 176
MalI GATC 3 cut(s) 37, 47, 134
MboI GATC 3 cut(s) 35, 45, 132
MboII GAAGA 2 cut(s) 40, 61
MflI RGATCY 2 cut(s) 35, 45
MnlI CCTC 2 cut(s) 112, 157
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
NdeII GATC 3 cut(s) 35, 45, 132
NlaIV GGNNCC 1 cut(s) 12
NmuCI GTSAC 2 cut(s) 107, 176
PfeI GAWTC 2 cut(s) 137, 196
PflFI GACNNNGTC 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 12
PsuI RGATCY 2 cut(s) 35, 45
PsyI GACNNNGTC 1 cut(s) 29
Sau3AI GATC 3 cut(s) 35, 45, 132
ScrFI CCNGG 1 cut(s) 15
SetI ASST 3 cut(s) 109, 168, 193
SfaNI GCATC 1 cut(s) 144
SspMI CTAG 2 cut(s) 87, 200
StyD4I CCNGG 1 cut(s) 13
TaaI ACNGT 2 cut(s) 22, 176
TaqI TCGA 2 cut(s) 135, 147
TfiI GAWTC 2 cut(s) 137, 196
TseFI GTSAC 2 cut(s) 107, 176
Tsp45I GTSAC 2 cut(s) 107, 176
Tth111I GACNNNGTC 1 cut(s) 29
XspI CTAG 2 cut(s) 87, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.