Rroxscaffold_1G00013730

Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0008935
Physical Location & Seq
Forward (+)
16937216 .. 16937431
216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00013730.1

Sequence Viewer

Length: 216 bp
ATGGATCTGGAGCCTGGGACCATGGACAGCGTCAGATCTGGACTCTACGGTCAGATCTTCCGTCCTGATAACTTCGTCTTCGGTCAGTCTGGTGCGGGAAACAACTGGGCCAAAGGTCACTACACCGAGGGGGCTGAGTTGATCGATTCGGTTCTTGATGTGGTGCGAAAGGAGGCCGAGAACTGTGACTGCTTGCAAGGTATGAATCCGGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04145 ko04540 ko05130 map04145 map04540 map05130
Pfam Domains
Protein Families
Tubulin Tubulin_C

Protein Analysis

71

Amino Acids

7.75

Weight (kDa)

4.33

Isoelectric Point (pI)

38.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Tubulin PF00091 1 - 68 7.5e-14 Tubulin/FtsZ family, GTPase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 48
AciI CCGC 1 cut(s) 95
AclWI GGATC 1 cut(s) 12
AjnI CCWGG 1 cut(s) 13
AlwI GGATC 1 cut(s) 12
AoxI GGCC 2 cut(s) 108, 174
AspS9I GGNCC 2 cut(s) 18, 108
AvaII GGWCC 1 cut(s) 18
BbsI GAAGAC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 15
BglII AGATCT 2 cut(s) 35, 54
Bme1390I CCNGG 1 cut(s) 15
Bme18I GGWCC 1 cut(s) 18
BmgT120I GGNCC 2 cut(s) 18, 108
BmiI GGNNCC 2 cut(s) 12, 19
BmrFI CCNGG 1 cut(s) 15
BmrI ACTGGG 1 cut(s) 115
BmuI ACTGGG 1 cut(s) 115
BpiI GAAGAC 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 29
Bsa29I ATCGAT 1 cut(s) 144
BsaJI CCNNGG 3 cut(s) 14, 21, 126
BsaWI WCCGGW 1 cut(s) 208
Bse1I ACTGG 1 cut(s) 110
BseBI CCWGG 1 cut(s) 15
BseCI ATCGAT 1 cut(s) 144
BseDI CCNNGG 3 cut(s) 14, 21, 126
BseMII CTCAG 1 cut(s) 126
BseNI ACTGG 1 cut(s) 110
BshFI GGCC 2 cut(s) 110, 176
BshVI ATCGAT 1 cut(s) 144
BsiSI CCGG 1 cut(s) 209
BslFI GGGAC 1 cut(s) 31
BsmFI GGGAC 1 cut(s) 31
BsnI GGCC 2 cut(s) 110, 176
Bsp143I GATC 4 cut(s) 4, 35, 54, 141
Bsp19I CCATGG 1 cut(s) 21
BspACI CCGC 1 cut(s) 95
BspANI GGCC 2 cut(s) 110, 176
BspCNI CTCAG 1 cut(s) 127
BspDI ATCGAT 1 cut(s) 144
BspLI GGNNCC 2 cut(s) 12, 19
BspPI GGATC 1 cut(s) 12
BsrI ACTGG 1 cut(s) 110
BssECI CCNNGG 3 cut(s) 14, 21, 126
BssMI GATC 4 cut(s) 4, 35, 54, 141
BssT1I CCWWGG 1 cut(s) 21
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 2 cut(s) 50, 185
BstC8I GCNNGC 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 135
BstDSI CCRYGG 1 cut(s) 21
BstKTI GATC 4 cut(s) 7, 38, 57, 144
BstMBI GATC 4 cut(s) 4, 35, 54, 141
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstV2I GAAGAC 1 cut(s) 70
BstX2I RGATCY 3 cut(s) 4, 35, 54
BstYI RGATCY 3 cut(s) 4, 35, 54
Bsu15I ATCGAT 1 cut(s) 144
BsuRI GGCC 2 cut(s) 110, 176
BsuTUI ATCGAT 1 cut(s) 144
BtgI CCRYGG 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 194
Cfr13I GGNCC 2 cut(s) 18, 108
ClaI ATCGAT 1 cut(s) 144
CseI GACGC 1 cut(s) 19
CviAII CATG 1 cut(s) 22
CviJI RGCY 4 cut(s) 13, 110, 134, 176
CviKI_1 RGCY 4 cut(s) 13, 110, 134, 176
DdeI CTNAG 1 cut(s) 135
DpnI GATC 4 cut(s) 6, 37, 56, 143
DpnII GATC 4 cut(s) 4, 35, 54, 141
DrdI GACNNNNNNGTC 1 cut(s) 48
DseDI GACNNNNNNGTC 1 cut(s) 48
Eco130I CCWWGG 1 cut(s) 21
Eco47I GGWCC 1 cut(s) 18
EcoRII CCWGG 1 cut(s) 13
EcoT14I CCWWGG 1 cut(s) 21
ErhI CCWWGG 1 cut(s) 21
FaeI CATG 1 cut(s) 25
FaiI YATR 2 cut(s) 23, 203
FaqI GGGAC 1 cut(s) 31
FatI CATG 1 cut(s) 21
FauI CCCGC 1 cut(s) 88
GsuI CTGGAG 1 cut(s) 29
HaeIII GGCC 2 cut(s) 110, 176
HapII CCGG 1 cut(s) 209
HgaI GACGC 1 cut(s) 19
Hin1II CATG 1 cut(s) 25
HinfI GANTC 3 cut(s) 42, 146, 205
HpaII CCGG 1 cut(s) 209
Hpy188I TCNGA 2 cut(s) 35, 54
Hpy188III TCNNGA 4 cut(s) 8, 39, 65, 155
HpyCH4III ACNGT 2 cut(s) 50, 185
HpyCH4V TGCA 1 cut(s) 196
HpyF3I CTNAG 1 cut(s) 135
Hsp92II CATG 1 cut(s) 25
Kzo9I GATC 4 cut(s) 4, 35, 54, 141
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 5 cut(s) 24, 27, 75, 78, 91
MaeIII GTNAC 2 cut(s) 116, 185
MalI GATC 4 cut(s) 6, 37, 56, 143
MboI GATC 4 cut(s) 4, 35, 54, 141
MboII GAAGA 2 cut(s) 49, 70
MflI RGATCY 3 cut(s) 4, 35, 54
MlyI GAGTC 1 cut(s) 36
MnlI CCTC 2 cut(s) 121, 166
MspI CCGG 1 cut(s) 209
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
NcoI CCATGG 1 cut(s) 21
NdeII GATC 4 cut(s) 4, 35, 54, 141
NlaIII CATG 1 cut(s) 25
NlaIV GGNNCC 2 cut(s) 12, 19
NmeAIII GCCGAG 1 cut(s) 202
NmuCI GTSAC 2 cut(s) 116, 185
PfeI GAWTC 2 cut(s) 146, 205
PflFI GACNNNGTC 1 cut(s) 29
PleI GAGTC 1 cut(s) 36
PpsI GAGTC 1 cut(s) 36
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 2 cut(s) 12, 19
PspPI GGNCC 2 cut(s) 18, 108
PsuI RGATCY 3 cut(s) 4, 35, 54
PsyI GACNNNGTC 1 cut(s) 29
Sau3AI GATC 4 cut(s) 4, 35, 54, 141
Sau96I GGNCC 2 cut(s) 18, 108
SchI GAGTC 1 cut(s) 36
ScrFI CCNGG 1 cut(s) 15
SetI ASST 2 cut(s) 118, 202
SinI GGWCC 1 cut(s) 18
SsiI CCGC 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 13
StyI CCWWGG 1 cut(s) 21
TaaI ACNGT 2 cut(s) 50, 185
TaqI TCGA 1 cut(s) 144
TaqII GACCGA 1 cut(s) 71
TfiI GAWTC 2 cut(s) 146, 205
TseFI GTSAC 2 cut(s) 116, 185
Tsp45I GTSAC 2 cut(s) 116, 185
TspGWI ACGGA 1 cut(s) 50
Tth111I GACNNNGTC 1 cut(s) 29
VpaK11BI GGWCC 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.