Rroxscaffold_6G00394720

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
15512973 .. 15516482
3510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00394720.1

Sequence Viewer

Length: 192 bp
ATGATCAAAGCACGCCCCAACCAAGGGAATGTGAAGAATCAGGACACAGTATGTGATTTTTATGGCCCAGAGTGTCCTGAATATGCCTCGTTGCTACCGGAAGGCTGGCTCACCAAGAAGAGAGTCATGCACCATGGGAGGAAATATATGGTTTGTTCCATAGAAAGAAGAAAAGAATCCAAAATGAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.37

Weight (kDa)

9.37

Isoelectric Point (pI)

93.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 23, 24
AluBI AGCT 1 cut(s) 189
AluI AGCT 1 cut(s) 189
AoxI GGCC 1 cut(s) 64
AspS9I GGNCC 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 103
BclI TGATCA 1 cut(s) 3
BmgT120I GGNCC 1 cut(s) 65
BsaJI CCNNGG 2 cut(s) 22, 133
BsaWI WCCGGW 1 cut(s) 97
Bsc4I CCNNNNNNNGG 2 cut(s) 23, 24
BseDI CCNNGG 2 cut(s) 22, 133
BseLI CCNNNNNNNGG 2 cut(s) 23, 24
BshFI GGCC 1 cut(s) 66
BsiSI CCGG 1 cut(s) 98
BslI CCNNNNNNNGG 2 cut(s) 23, 24
BsnI GGCC 1 cut(s) 66
Bsp143I GATC 1 cut(s) 3
Bsp19I CCATGG 1 cut(s) 133
BspANI GGCC 1 cut(s) 66
BssECI CCNNGG 2 cut(s) 22, 133
BssMI GATC 1 cut(s) 3
BssT1I CCWWGG 2 cut(s) 22, 133
Bst4CI ACNGT 1 cut(s) 49
Bst6I CTCTTC 1 cut(s) 113
BstC8I GCNNGC 2 cut(s) 13, 107
BstDSI CCRYGG 1 cut(s) 133
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BsuRI GGCC 1 cut(s) 66
BtgI CCRYGG 1 cut(s) 133
Cac8I GCNNGC 2 cut(s) 13, 107
Cfr13I GGNCC 1 cut(s) 65
CviAII CATG 2 cut(s) 127, 134
CviJI RGCY 4 cut(s) 66, 105, 109, 189
CviKI_1 RGCY 4 cut(s) 66, 105, 109, 189
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 113
EarI CTCTTC 1 cut(s) 113
Eco130I CCWWGG 2 cut(s) 22, 133
EcoT14I CCWWGG 2 cut(s) 22, 133
ErhI CCWWGG 2 cut(s) 22, 133
FaeI CATG 2 cut(s) 130, 137
FaiI YATR 8 cut(s) 52, 63, 84, 128, 135, 147, 149, 161
FatI CATG 2 cut(s) 126, 133
FbaI TGATCA 1 cut(s) 3
HaeIII GGCC 1 cut(s) 66
HapII CCGG 1 cut(s) 98
Hin1II CATG 2 cut(s) 130, 137
HinfI GANTC 3 cut(s) 37, 123, 176
HpaII CCGG 1 cut(s) 98
HphI GGTGA 1 cut(s) 103
Hpy188III TCNNGA 2 cut(s) 41, 77
HpyAV CCTTC 1 cut(s) 95
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 130
Hsp92II CATG 2 cut(s) 130, 137
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 5 cut(s) 26, 81, 90, 91, 111
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 3 cut(s) 46, 130, 180
MlyI GAGTC 1 cut(s) 132
MnlI CCTC 2 cut(s) 97, 132
MspI CCGG 1 cut(s) 98
NcoI CCATGG 1 cut(s) 133
NdeII GATC 1 cut(s) 3
NlaIII CATG 2 cut(s) 130, 137
PfeI GAWTC 2 cut(s) 37, 176
PleI GAGTC 1 cut(s) 131
PpsI GAGTC 1 cut(s) 131
PspPI GGNCC 1 cut(s) 65
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 65
SchI GAGTC 1 cut(s) 132
SetI ASST 1 cut(s) 191
StyI CCWWGG 2 cut(s) 22, 133
TaaI ACNGT 1 cut(s) 49
TfiI GAWTC 2 cut(s) 37, 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.