Rroxscaffold_4G00293500

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
13742282 .. 13742795
514 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00293500.1

Sequence Viewer

Length: 168 bp
ATGGTTTCCAAACAATTTGAGATTGTAAGTCATTATTCTCCAGAACAGATCTTTTTATCAGACTCCGACACTCCATTCAGGAAGTTGGAACACATCCTTGAACACATATGGGGTCATGGCGGTTGCATCCTTAACATTATTTCAAGGAAAATTAAGTTGTCTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.41

Weight (kDa)

6.39

Isoelectric Point (pI)

69.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 120
AgsI TTSAA 2 cut(s) 101, 144
BglII AGATCT 1 cut(s) 48
BmsI GCATC 1 cut(s) 135
BpmI CTGGAG 1 cut(s) 24
BseGI GGATG 2 cut(s) 93, 126
Bsp143I GATC 1 cut(s) 48
BspACI CCGC 1 cut(s) 120
BssMI GATC 1 cut(s) 48
BstF5I GGATG 2 cut(s) 93, 126
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstX2I RGATCY 1 cut(s) 48
BstYI RGATCY 1 cut(s) 48
BtsCI GGATG 2 cut(s) 93, 126
CviAII CATG 1 cut(s) 116
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
FaeI CATG 1 cut(s) 119
FaiI YATR 3 cut(s) 107, 109, 117
FatI CATG 1 cut(s) 115
FauNDI CATATG 1 cut(s) 107
FokI GGATG 2 cut(s) 80, 113
GsuI CTGGAG 1 cut(s) 24
Hin1II CATG 1 cut(s) 119
HinfI GANTC 1 cut(s) 62
Hpy188I TCNGA 3 cut(s) 61, 67, 163
Hpy188III TCNNGA 2 cut(s) 41, 79
HpyCH4V TGCA 1 cut(s) 126
Hsp92II CATG 1 cut(s) 119
Kzo9I GATC 1 cut(s) 48
LpnPI CCDG 2 cut(s) 54, 64
LweI GCATC 1 cut(s) 135
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MflI RGATCY 1 cut(s) 48
MluCI AATT 2 cut(s) 14, 150
MlyI GAGTC 1 cut(s) 56
MmeI TCCRAC 2 cut(s) 66, 90
MseI TTAA 2 cut(s) 132, 153
NdeI CATATG 1 cut(s) 107
NdeII GATC 1 cut(s) 48
NlaIII CATG 1 cut(s) 119
PleI GAGTC 1 cut(s) 56
PpsI GAGTC 1 cut(s) 56
PsuI RGATCY 1 cut(s) 48
SaqAI TTAA 2 cut(s) 132, 153
Sau3AI GATC 1 cut(s) 48
SchI GAGTC 1 cut(s) 56
SfaNI GCATC 1 cut(s) 135
SgeI CNNG 5 cut(s) 53, 91, 110, 128, 156
Sse9I AATT 2 cut(s) 14, 150
SsiI CCGC 1 cut(s) 120
TasI AATT 2 cut(s) 14, 150
Tru1I TTAA 2 cut(s) 132, 153
Tru9I TTAA 2 cut(s) 132, 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.