Rroxscaffold_5G00372260

HORMA domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
53734826 .. 53737666
2841 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00372260.1

Sequence Viewer

Length: 156 bp
ATGAGGATAAAAAGAATGCCAATGGATGCAGAGTCTTGCAGAATTATTGAATGGATGGAAAAAGGTGTTTGCAATGCCTTGCAGAAGAAGTATCTGAAACTCTTTTGTTCTGTGTGTGAAGTCGTTGAAGGACCAATGATAGGAATCCACATGTAA

Protein Analysis

51

Amino Acids

5.95

Weight (kDa)

8.45

Isoelectric Point (pI)

41.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HORMA PF02301 4 - 35 1.7e-06 HORMA domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 140
AflIII ACRYGT 1 cut(s) 150
AgsI TTSAA 2 cut(s) 50, 128
AspS9I GGNCC 1 cut(s) 131
AvaII GGWCC 1 cut(s) 131
BccI CCATC 1 cut(s) 49
Bme18I GGWCC 1 cut(s) 131
BmgT120I GGNCC 1 cut(s) 131
BmsI GCATC 1 cut(s) 16
BsaBI GATNNNNATC 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 140
Bse3DI GCAATG 1 cut(s) 79
Bse8I GATNNNNATC 1 cut(s) 143
BseGI GGATG 2 cut(s) 31, 60
BseJI GATNNNNATC 1 cut(s) 143
BseLI CCNNNNNNNGG 1 cut(s) 140
BseMI GCAATG 1 cut(s) 79
BslI CCNNNNNNNGG 1 cut(s) 140
BsmI GAATGC 1 cut(s) 21
BsrDI GCAATG 1 cut(s) 79
BstF5I GGATG 2 cut(s) 31, 60
BstNSI RCATGY 1 cut(s) 154
BtsCI GGATG 2 cut(s) 31, 60
Cfr13I GGNCC 1 cut(s) 131
CviAII CATG 1 cut(s) 151
Eco47I GGWCC 1 cut(s) 131
FaeI CATG 1 cut(s) 154
FaiI YATR 1 cut(s) 152
FatI CATG 1 cut(s) 150
FokI GGATG 2 cut(s) 38, 67
FspEI CC 9 cut(s) 8, 33, 37, 41, 48, 91, 114, 126, 147
Hin1II CATG 1 cut(s) 154
HinfI GANTC 2 cut(s) 32, 144
Hpy188I TCNGA 1 cut(s) 96
HpyAV CCTTC 1 cut(s) 122
HpyCH4V TGCA 4 cut(s) 29, 39, 72, 82
Hsp92II CATG 1 cut(s) 154
LweI GCATC 1 cut(s) 16
MboII GAAGA 1 cut(s) 97
MluCI AATT 1 cut(s) 42
MlyI GAGTC 1 cut(s) 41
Mva1269I GAATGC 1 cut(s) 21
NlaIII CATG 1 cut(s) 154
NspI RCATGY 1 cut(s) 154
PciI ACATGT 1 cut(s) 150
PctI GAATGC 1 cut(s) 21
PfeI GAWTC 1 cut(s) 144
PleI GAGTC 1 cut(s) 40
PpsI GAGTC 1 cut(s) 40
PscI ACATGT 1 cut(s) 150
PspPI GGNCC 1 cut(s) 131
Sau96I GGNCC 1 cut(s) 131
SchI GAGTC 1 cut(s) 41
SetI ASST 1 cut(s) 67
SfaNI GCATC 1 cut(s) 16
SgeI CNNG 2 cut(s) 48, 91
SinI GGWCC 1 cut(s) 131
Sse9I AATT 1 cut(s) 42
TasI AATT 1 cut(s) 42
TfiI GAWTC 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 131
XceI RCATGY 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.