Rroxscaffold_6G00420680

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
OG0016414
Physical Location & Seq
Forward (+)
41860857 .. 41867184
6328 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00420680.1

Sequence Viewer

Length: 360 bp
ATGTTTGGTCTAAAGAAGGCTGTTAATAGGCCTGAATTGTTTATGTGGTTATCAGTTATCACTTGGCAACATTATGATGGTGATGTTGAAGAACACTATCTGGACTTTATAGGAACTGAAAGTTATTTGGAAAACGACATAAAGAAAACACAATACACTGGTGGTCAATCTGAGGGGACCCTGGCAATTAAAATCTTTTGGGAGGTATTGACGCTCGATTGGGAGTTGATTGTCGACTCGGTCGAATTGAGGATTATCAAGATACAATGCATTACTGAACTCAAAGTTGTCTTTGCTGCACCTACGATCAAGTATGGTTTGACAGCCAAAGCACGATATCCCCGGCTAAAGCCAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.84

Weight (kDa)

5.4

Isoelectric Point (pI)

23.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 234
AgsI TTSAA 1 cut(s) 89
AjnI CCWGG 1 cut(s) 180
AoxI GGCC 1 cut(s) 29
ApeKI GCWGC 1 cut(s) 296
AspS9I GGNCC 1 cut(s) 177
AsuC2I CCSGG 1 cut(s) 343
AsuHPI GGTGA 1 cut(s) 92
AvaII GGWCC 1 cut(s) 177
BbvI GCAGC 1 cut(s) 283
BccI CCATC 1 cut(s) 71
BciT130I CCWGG 1 cut(s) 182
BcnI CCSGG 1 cut(s) 343
BisI GCNGC 1 cut(s) 297
BlsI GCNGC 1 cut(s) 298
Bme1390I CCNGG 2 cut(s) 182, 343
Bme18I GGWCC 1 cut(s) 177
BmgT120I GGNCC 1 cut(s) 177
BmiI GGNNCC 2 cut(s) 178, 179
BmrFI CCNGG 2 cut(s) 182, 343
BpuMI CCSGG 1 cut(s) 343
BsaJI CCNNGG 2 cut(s) 180, 341
Bse1I ACTGG 1 cut(s) 163
BseBI CCWGG 1 cut(s) 182
BseDI CCNNGG 2 cut(s) 180, 341
BseMII CTCAG 1 cut(s) 162
BseNI ACTGG 1 cut(s) 163
BseXI GCAGC 1 cut(s) 283
BsgI GTGCAG 1 cut(s) 282
Bsh1285I CGRYCG 1 cut(s) 243
BshFI GGCC 1 cut(s) 31
BsiEI CGRYCG 1 cut(s) 243
BsiSI CCGG 1 cut(s) 343
BslFI GGGAC 1 cut(s) 190
BsmFI GGGAC 1 cut(s) 190
BsnI GGCC 1 cut(s) 31
Bsp143I GATC 1 cut(s) 306
BspANI GGCC 1 cut(s) 31
BspCNI CTCAG 1 cut(s) 163
BspLI GGNNCC 2 cut(s) 178, 179
BsrI ACTGG 1 cut(s) 163
BssECI CCNNGG 2 cut(s) 180, 341
BssMI GATC 1 cut(s) 306
Bst2UI CCWGG 1 cut(s) 182
BstDEI CTNAG 1 cut(s) 171
BstKTI GATC 1 cut(s) 309
BstMBI GATC 1 cut(s) 306
BstMCI CGRYCG 1 cut(s) 243
BstNI CCWGG 1 cut(s) 182
BstSCI CCNGG 2 cut(s) 180, 341
BstV1I GCAGC 1 cut(s) 283
BsuRI GGCC 1 cut(s) 31
BtsIMutI CAGTG 1 cut(s) 156
Cfr13I GGNCC 1 cut(s) 177
CseI GACGC 1 cut(s) 220
CviJI RGCY 5 cut(s) 20, 31, 326, 346, 352
CviKI_1 RGCY 5 cut(s) 20, 31, 326, 346, 352
DdeI CTNAG 1 cut(s) 171
DpnI GATC 1 cut(s) 308
DpnII GATC 1 cut(s) 306
Eco147I AGGCCT 1 cut(s) 31
Eco32I GATATC 1 cut(s) 338
Eco47I GGWCC 1 cut(s) 177
EcoO109I RGGNCCY 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 180
EcoRV GATATC 1 cut(s) 338
EcoT22I ATGCAT 1 cut(s) 272
FaiI YATR 5 cut(s) 44, 75, 110, 140, 315
FaqI GGGAC 1 cut(s) 190
FblI GTMKAC 1 cut(s) 234
Fnu4HI GCNGC 1 cut(s) 297
Fsp4HI GCNGC 1 cut(s) 297
GluI GCNGC 1 cut(s) 297
HaeIII GGCC 1 cut(s) 31
HapII CCGG 1 cut(s) 343
HgaI GACGC 1 cut(s) 220
HincII GTYRAC 1 cut(s) 235
HindII GTYRAC 1 cut(s) 235
HinfI GANTC 1 cut(s) 236
HpaII CCGG 1 cut(s) 343
HphI GGTGA 1 cut(s) 92
Hpy166II GTNNAC 1 cut(s) 235
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 101, 259
Hpy8I GTNNAC 1 cut(s) 235
HpyAV CCTTC 1 cut(s) 10
HpyCH4V TGCA 2 cut(s) 270, 299
HpyF3I CTNAG 1 cut(s) 171
KflI GGGWCCC 1 cut(s) 177
Kzo9I GATC 1 cut(s) 306
LpnPI CCDG 6 cut(s) 45, 86, 144, 167, 194, 356
Lsp1109I GCAGC 1 cut(s) 283
MalI GATC 1 cut(s) 308
MboI GATC 1 cut(s) 306
MboII GAAGA 1 cut(s) 101
MluCI AATT 3 cut(s) 35, 186, 245
MlyI GAGTC 1 cut(s) 230
MnlI CCTC 3 cut(s) 166, 196, 243
Mph1103I ATGCAT 1 cut(s) 272
MseI TTAA 3 cut(s) 24, 189, 358
MslI CAYNNNNRTG 1 cut(s) 75
MspI CCGG 1 cut(s) 343
MspR9I CCNGG 2 cut(s) 182, 343
MvaI CCWGG 1 cut(s) 182
NciI CCSGG 1 cut(s) 343
NdeII GATC 1 cut(s) 306
NlaIV GGNNCC 2 cut(s) 178, 179
NsiI ATGCAT 1 cut(s) 272
PceI AGGCCT 1 cut(s) 31
PcsI WCGNNNNNNNCGW 1 cut(s) 240
PflFI GACNNNGTC 1 cut(s) 239
PkrI GCNGC 1 cut(s) 298
PleI GAGTC 1 cut(s) 230
PpsI GAGTC 1 cut(s) 230
PpuMI RGGWCCY 1 cut(s) 177
Psp5II RGGWCCY 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 180
PspGI CCWGG 1 cut(s) 180
PspN4I GGNNCC 2 cut(s) 178, 179
PspPI GGNCC 1 cut(s) 177
PspPPI RGGWCCY 1 cut(s) 177
PsyI GACNNNGTC 1 cut(s) 239
RseI CAYNNNNRTG 1 cut(s) 75
SalI GTCGAC 1 cut(s) 233
SaqAI TTAA 3 cut(s) 24, 189, 358
SatI GCNGC 1 cut(s) 297
Sau3AI GATC 1 cut(s) 306
Sau96I GGNCC 1 cut(s) 177
SchI GAGTC 1 cut(s) 230
ScrFI CCNGG 2 cut(s) 182, 343
SetI ASST 2 cut(s) 207, 304
SinI GGWCC 1 cut(s) 177
SmiMI CAYNNNNRTG 1 cut(s) 75
Sse9I AATT 3 cut(s) 35, 186, 245
SseBI AGGCCT 1 cut(s) 31
StuI AGGCCT 1 cut(s) 31
StyD4I CCNGG 2 cut(s) 180, 341
TaqI TCGA 3 cut(s) 216, 234, 243
TaqII GACCGA 1 cut(s) 229
TasI AATT 3 cut(s) 35, 186, 245
Tru1I TTAA 3 cut(s) 24, 189, 358
Tru9I TTAA 3 cut(s) 24, 189, 358
TscAI CASTG 1 cut(s) 163
TseI GCWGC 1 cut(s) 296
TspRI CASTG 1 cut(s) 163
Tth111I GACNNNGTC 1 cut(s) 239
VpaK11BI GGWCC 1 cut(s) 177
XmiI GTMKAC 1 cut(s) 234
Zsp2I ATGCAT 1 cut(s) 272
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.