Rh4AG348700

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
65704135 .. 65705720
1586 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG348700.1

Sequence Viewer

Length: 354 bp
ATGCAAAGACAAGACATACATTTGGAAATCCTCCGGTCTAAACTTCATGATCTAGCTATTCAGCTCATACTTCATAAGCCTGTGAAAAGCCCAATAGCTAACTGCAGTGATATTCATGGACAATCTCATCATCTTCGAGAGCTTTTCCGTAGTAGAGGAAAGTTATCACTTGGCAACATTATGATGATTTTTCTATTTTCAAATGCATTCTATGTAGTAATTGATCTGATATCACCATCTTGGCTAAAATTGTTTAATGCCGGGAAATTTAATCAGAACACACAATTCACTGGTGGTCAATCTGAGGGGACCCTGGCGATTAAAATCTTTTGGGAGGTTTCAAAATCTCCATAG

Protein Analysis

117

Amino Acids

13.36

Weight (kDa)

9.73

Isoelectric Point (pI)

52.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 266
AgsI TTSAA 2 cut(s) 201, 342
AjnI CCWGG 1 cut(s) 312
AluBI AGCT 4 cut(s) 56, 64, 98, 142
AluI AGCT 4 cut(s) 56, 64, 98, 142
ApoI RAATTY 1 cut(s) 266
AspS9I GGNCC 1 cut(s) 309
AsuC2I CCSGG 1 cut(s) 262
AsuHPI GGTGA 1 cut(s) 225
AvaII GGWCC 1 cut(s) 309
BccI CCATC 1 cut(s) 244
BciT130I CCWGG 1 cut(s) 314
BcnI CCSGG 1 cut(s) 262
BfaI CTAG 1 cut(s) 53
BfmI CTRYAG 1 cut(s) 103
Bme1390I CCNGG 2 cut(s) 262, 314
Bme18I GGWCC 1 cut(s) 309
BmgT120I GGNCC 1 cut(s) 309
BmiI GGNNCC 2 cut(s) 310, 311
BmrFI CCNGG 2 cut(s) 262, 314
BpuMI CCSGG 1 cut(s) 262
BsaBI GATNNNNATC 1 cut(s) 323
BsaJI CCNNGG 1 cut(s) 312
BsaWI WCCGGW 1 cut(s) 33
Bse1I ACTGG 1 cut(s) 295
Bse8I GATNNNNATC 1 cut(s) 323
BseBI CCWGG 1 cut(s) 314
BseDI CCNNGG 1 cut(s) 312
BseJI GATNNNNATC 1 cut(s) 323
BseMII CTCAG 1 cut(s) 294
BseNI ACTGG 1 cut(s) 295
BsiSI CCGG 2 cut(s) 34, 261
BslFI GGGAC 1 cut(s) 322
BsmFI GGGAC 1 cut(s) 322
BsmI GAATGC 1 cut(s) 206
Bsp143I GATC 2 cut(s) 49, 223
BspCNI CTCAG 1 cut(s) 295
BspHI TCATGA 1 cut(s) 46
BspLI GGNNCC 2 cut(s) 310, 311
BspMAI CTGCAG 1 cut(s) 107
BsrI ACTGG 1 cut(s) 295
BssECI CCNNGG 1 cut(s) 312
BssMI GATC 2 cut(s) 49, 223
Bst2UI CCWGG 1 cut(s) 314
BstDEI CTNAG 1 cut(s) 303
BstKTI GATC 2 cut(s) 52, 226
BstMBI GATC 2 cut(s) 49, 223
BstNI CCWGG 1 cut(s) 314
BstSCI CCNGG 2 cut(s) 260, 312
BstSFI CTRYAG 1 cut(s) 103
BtsI GCAGTG 1 cut(s) 112
BtsIMutI CAGTG 2 cut(s) 112, 288
CciI TCATGA 1 cut(s) 46
Cfr13I GGNCC 1 cut(s) 309
CviAII CATG 2 cut(s) 47, 116
CviJI RGCY 7 cut(s) 56, 64, 79, 90, 98, 142, 244
CviKI_1 RGCY 7 cut(s) 56, 64, 79, 90, 98, 142, 244
DdeI CTNAG 1 cut(s) 303
DpnI GATC 2 cut(s) 51, 225
DpnII GATC 2 cut(s) 49, 223
Eco32I GATATC 1 cut(s) 231
Eco47I GGWCC 1 cut(s) 309
EcoO109I RGGNCCY 1 cut(s) 309
EcoRII CCWGG 1 cut(s) 312
EcoRV GATATC 1 cut(s) 231
EcoT22I ATGCAT 1 cut(s) 208
FaeI CATG 2 cut(s) 50, 119
FaiI YATR 8 cut(s) 17, 48, 68, 75, 117, 182, 213, 352
FaqI GGGAC 1 cut(s) 322
FatI CATG 2 cut(s) 46, 115
FspBI CTAG 1 cut(s) 53
HapII CCGG 2 cut(s) 34, 261
Hin1II CATG 2 cut(s) 50, 119
HpaII CCGG 2 cut(s) 34, 261
HphI GGTGA 1 cut(s) 225
Hpy188I TCNGA 3 cut(s) 228, 276, 304
Hpy188III TCNNGA 2 cut(s) 47, 137
HpyCH4V TGCA 3 cut(s) 4, 105, 206
HpyF3I CTNAG 1 cut(s) 303
Hsp92II CATG 2 cut(s) 50, 119
KflI GGGWCCC 1 cut(s) 309
Kzo9I GATC 2 cut(s) 49, 223
LpnPI CCDG 6 cut(s) 47, 93, 274, 276, 299, 326
MaeI CTAG 1 cut(s) 53
MalI GATC 2 cut(s) 51, 225
MboI GATC 2 cut(s) 49, 223
MboII GAAGA 1 cut(s) 125
MluCI AATT 4 cut(s) 219, 248, 266, 284
MnlI CCTC 4 cut(s) 41, 149, 298, 328
Mph1103I ATGCAT 1 cut(s) 208
MseI TTAA 3 cut(s) 255, 270, 321
MslI CAYNNNNRTG 1 cut(s) 182
MspI CCGG 2 cut(s) 34, 261
MspR9I CCNGG 2 cut(s) 262, 314
Mva1269I GAATGC 1 cut(s) 206
MvaI CCWGG 1 cut(s) 314
NciI CCSGG 1 cut(s) 262
NdeII GATC 2 cut(s) 49, 223
NlaIII CATG 2 cut(s) 50, 119
NlaIV GGNNCC 2 cut(s) 310, 311
NsiI ATGCAT 1 cut(s) 208
PagI TCATGA 1 cut(s) 46
PctI GAATGC 1 cut(s) 206
PpuMI RGGWCCY 1 cut(s) 309
Psp5II RGGWCCY 1 cut(s) 309
Psp6I CCWGG 1 cut(s) 312
PspGI CCWGG 1 cut(s) 312
PspN4I GGNNCC 2 cut(s) 310, 311
PspPI GGNCC 1 cut(s) 309
PspPPI RGGWCCY 1 cut(s) 309
PstI CTGCAG 1 cut(s) 107
RseI CAYNNNNRTG 1 cut(s) 182
SaqAI TTAA 3 cut(s) 255, 270, 321
Sau3AI GATC 2 cut(s) 49, 223
Sau96I GGNCC 1 cut(s) 309
ScrFI CCNGG 2 cut(s) 262, 314
SetI ASST 5 cut(s) 58, 66, 100, 144, 339
SfcI CTRYAG 1 cut(s) 103
SinI GGWCC 1 cut(s) 309
SmiMI CAYNNNNRTG 1 cut(s) 182
Sse9I AATT 4 cut(s) 219, 248, 266, 284
SspMI CTAG 1 cut(s) 53
StyD4I CCNGG 2 cut(s) 260, 312
TaqI TCGA 1 cut(s) 136
TasI AATT 4 cut(s) 219, 248, 266, 284
Tru1I TTAA 3 cut(s) 255, 270, 321
Tru9I TTAA 3 cut(s) 255, 270, 321
TscAI CASTG 2 cut(s) 112, 295
TspDTI ATGAA 3 cut(s) 35, 62, 104
TspGWI ACGGA 1 cut(s) 137
TspRI CASTG 2 cut(s) 112, 295
VpaK11BI GGWCC 1 cut(s) 309
XapI RAATTY 1 cut(s) 266
XspI CTAG 1 cut(s) 53
Zsp2I ATGCAT 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.