Rh4DG351200

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
57290583 .. 57296305
5723 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG351200.1

Sequence Viewer

Length: 342 bp
ATGACCTTTAATTTTCACCTCCGGTCTAAACTTCATGATCTAGCTATTCAGCTCATACTTCATAAGCCTGTGAAAAGCCCAATAGCTAACTGCAGTGATATTCATGGACAATCTCATCATCTTCGAGAGCTTTTCCGTAGTAGAGGAAAGTTATCACTTGGCAACATTATGATGATTTTTCTATTTTCAAATGCATTCTATGTAGTAATTGATCTGATATCACCATCTTGGCTAAAATTGTTTAATGCCGGGAAATTTAATCAGAACACACAATTCACTGGTGGTCAATCTGAGGGGACCCTGGCGATTAAAATCTTTTGGGAGGTTTCAAAATCTCCATAG

Protein Analysis

113

Amino Acids

12.87

Weight (kDa)

9.92

Isoelectric Point (pI)

46.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 254
AgsI TTSAA 2 cut(s) 189, 330
AjnI CCWGG 1 cut(s) 300
AluBI AGCT 4 cut(s) 44, 52, 86, 130
AluI AGCT 4 cut(s) 44, 52, 86, 130
ApoI RAATTY 1 cut(s) 254
AspS9I GGNCC 1 cut(s) 297
AsuC2I CCSGG 1 cut(s) 250
AsuHPI GGTGA 2 cut(s) 8, 213
AvaII GGWCC 1 cut(s) 297
BccI CCATC 1 cut(s) 232
BciT130I CCWGG 1 cut(s) 302
BcnI CCSGG 1 cut(s) 250
BfaI CTAG 1 cut(s) 41
BfmI CTRYAG 1 cut(s) 91
Bme1390I CCNGG 2 cut(s) 250, 302
Bme18I GGWCC 1 cut(s) 297
BmgT120I GGNCC 1 cut(s) 297
BmiI GGNNCC 2 cut(s) 298, 299
BmrFI CCNGG 2 cut(s) 250, 302
BpuMI CCSGG 1 cut(s) 250
BsaBI GATNNNNATC 1 cut(s) 311
BsaJI CCNNGG 1 cut(s) 300
BsaWI WCCGGW 1 cut(s) 21
Bse1I ACTGG 1 cut(s) 283
Bse8I GATNNNNATC 1 cut(s) 311
BseBI CCWGG 1 cut(s) 302
BseDI CCNNGG 1 cut(s) 300
BseJI GATNNNNATC 1 cut(s) 311
BseMII CTCAG 1 cut(s) 282
BseNI ACTGG 1 cut(s) 283
BsiSI CCGG 2 cut(s) 22, 249
BslFI GGGAC 1 cut(s) 310
BsmFI GGGAC 1 cut(s) 310
BsmI GAATGC 1 cut(s) 194
Bsp143I GATC 2 cut(s) 37, 211
BspCNI CTCAG 1 cut(s) 283
BspHI TCATGA 1 cut(s) 34
BspLI GGNNCC 2 cut(s) 298, 299
BspMAI CTGCAG 1 cut(s) 95
BsrI ACTGG 1 cut(s) 283
BssECI CCNNGG 1 cut(s) 300
BssMI GATC 2 cut(s) 37, 211
Bst2UI CCWGG 1 cut(s) 302
BstDEI CTNAG 1 cut(s) 291
BstKTI GATC 2 cut(s) 40, 214
BstMBI GATC 2 cut(s) 37, 211
BstNI CCWGG 1 cut(s) 302
BstSCI CCNGG 2 cut(s) 248, 300
BstSFI CTRYAG 1 cut(s) 91
BtsI GCAGTG 1 cut(s) 100
BtsIMutI CAGTG 2 cut(s) 100, 276
CciI TCATGA 1 cut(s) 34
Cfr13I GGNCC 1 cut(s) 297
CviAII CATG 2 cut(s) 35, 104
CviJI RGCY 7 cut(s) 44, 52, 67, 78, 86, 130, 232
CviKI_1 RGCY 7 cut(s) 44, 52, 67, 78, 86, 130, 232
DdeI CTNAG 1 cut(s) 291
DpnI GATC 2 cut(s) 39, 213
DpnII GATC 2 cut(s) 37, 211
Eco32I GATATC 1 cut(s) 219
Eco47I GGWCC 1 cut(s) 297
EcoO109I RGGNCCY 1 cut(s) 297
EcoRII CCWGG 1 cut(s) 300
EcoRV GATATC 1 cut(s) 219
EcoT22I ATGCAT 1 cut(s) 196
FaeI CATG 2 cut(s) 38, 107
FaiI YATR 7 cut(s) 36, 56, 63, 105, 170, 201, 340
FaqI GGGAC 1 cut(s) 310
FatI CATG 2 cut(s) 34, 103
FspBI CTAG 1 cut(s) 41
HapII CCGG 2 cut(s) 22, 249
Hin1II CATG 2 cut(s) 38, 107
HpaII CCGG 2 cut(s) 22, 249
HphI GGTGA 2 cut(s) 8, 213
Hpy188I TCNGA 3 cut(s) 216, 264, 292
Hpy188III TCNNGA 2 cut(s) 35, 125
HpyCH4V TGCA 2 cut(s) 93, 194
HpyF3I CTNAG 1 cut(s) 291
Hsp92II CATG 2 cut(s) 38, 107
KflI GGGWCCC 1 cut(s) 297
Kzo9I GATC 2 cut(s) 37, 211
LpnPI CCDG 6 cut(s) 35, 81, 262, 264, 287, 314
MaeI CTAG 1 cut(s) 41
MalI GATC 2 cut(s) 39, 213
MboI GATC 2 cut(s) 37, 211
MboII GAAGA 1 cut(s) 113
MluCI AATT 5 cut(s) 10, 207, 236, 254, 272
MnlI CCTC 4 cut(s) 29, 137, 286, 316
Mph1103I ATGCAT 1 cut(s) 196
MseI TTAA 4 cut(s) 9, 243, 258, 309
MslI CAYNNNNRTG 1 cut(s) 170
MspI CCGG 2 cut(s) 22, 249
MspR9I CCNGG 2 cut(s) 250, 302
Mva1269I GAATGC 1 cut(s) 194
MvaI CCWGG 1 cut(s) 302
NciI CCSGG 1 cut(s) 250
NdeII GATC 2 cut(s) 37, 211
NlaIII CATG 2 cut(s) 38, 107
NlaIV GGNNCC 2 cut(s) 298, 299
NsiI ATGCAT 1 cut(s) 196
PagI TCATGA 1 cut(s) 34
PctI GAATGC 1 cut(s) 194
PpuMI RGGWCCY 1 cut(s) 297
Psp5II RGGWCCY 1 cut(s) 297
Psp6I CCWGG 1 cut(s) 300
PspGI CCWGG 1 cut(s) 300
PspN4I GGNNCC 2 cut(s) 298, 299
PspPI GGNCC 1 cut(s) 297
PspPPI RGGWCCY 1 cut(s) 297
PstI CTGCAG 1 cut(s) 95
RseI CAYNNNNRTG 1 cut(s) 170
SaqAI TTAA 4 cut(s) 9, 243, 258, 309
Sau3AI GATC 2 cut(s) 37, 211
Sau96I GGNCC 1 cut(s) 297
ScrFI CCNGG 2 cut(s) 250, 302
SetI ASST 7 cut(s) 8, 21, 46, 54, 88, 132, 327
SfcI CTRYAG 1 cut(s) 91
SinI GGWCC 1 cut(s) 297
SmiMI CAYNNNNRTG 1 cut(s) 170
Sse9I AATT 5 cut(s) 10, 207, 236, 254, 272
SspMI CTAG 1 cut(s) 41
StyD4I CCNGG 2 cut(s) 248, 300
TaqI TCGA 1 cut(s) 124
TasI AATT 5 cut(s) 10, 207, 236, 254, 272
Tru1I TTAA 4 cut(s) 9, 243, 258, 309
Tru9I TTAA 4 cut(s) 9, 243, 258, 309
TscAI CASTG 2 cut(s) 100, 283
TspDTI ATGAA 3 cut(s) 23, 50, 92
TspGWI ACGGA 1 cut(s) 125
TspRI CASTG 2 cut(s) 100, 283
VpaK11BI GGWCC 1 cut(s) 297
XapI RAATTY 1 cut(s) 254
XspI CTAG 1 cut(s) 41
Zsp2I ATGCAT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.