Rroxscaffold_7G00194280

Belongs to the NPH3 family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
36031930 .. 36048930
17001 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00194280.1

Sequence Viewer

Length: 150 bp
ATGTGGGATGCAATTGCTTTTGGATACATCAATGTATCAAGGTTTTGCACCACTAGGCTTCCTAGTGATGTTGTTGTTGAAGTTGGAGAAATGTCTTTCCATCTTCATAATTTTCTTTTGCTCTCAAGATGTGGAGTCATGGAAAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.58

Weight (kDa)

5.38

Isoelectric Point (pI)

41.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 80
BccI CCATC 1 cut(s) 108
BciVI GTATCC 1 cut(s) 17
BfaI CTAG 2 cut(s) 54, 63
BfuI GTATCC 1 cut(s) 17
BpuEI CTTGAG 1 cut(s) 109
BseGI GGATG 1 cut(s) 13
BstF5I GGATG 1 cut(s) 13
BsuI GTATCC 1 cut(s) 17
BtsCI GGATG 1 cut(s) 13
CviAII CATG 1 cut(s) 139
CviJI RGCY 1 cut(s) 58
CviKI_1 RGCY 1 cut(s) 58
FaeI CATG 1 cut(s) 142
FaiI YATR 2 cut(s) 108, 140
FatI CATG 1 cut(s) 138
FokI GGATG 1 cut(s) 20
FspBI CTAG 2 cut(s) 54, 63
FspEI CC 9 cut(s) 6, 25, 40, 64, 69, 75, 113, 117, 125
Hin1II CATG 1 cut(s) 142
HinfI GANTC 1 cut(s) 135
Hpy188III TCNNGA 1 cut(s) 126
HpyCH4V TGCA 2 cut(s) 11, 48
Hsp92II CATG 1 cut(s) 142
MaeI CTAG 2 cut(s) 54, 63
MboII GAAGA 1 cut(s) 95
MfeI CAATTG 1 cut(s) 12
MluCI AATT 2 cut(s) 12, 109
MlyI GAGTC 1 cut(s) 144
MmeI TCCRAC 1 cut(s) 64
MunI CAATTG 1 cut(s) 12
NlaIII CATG 1 cut(s) 142
PleI GAGTC 1 cut(s) 143
PpsI GAGTC 1 cut(s) 143
SchI GAGTC 1 cut(s) 144
SetI ASST 1 cut(s) 44
SgeI CNNG 4 cut(s) 51, 66, 75, 138
SmlI CTYRAG 1 cut(s) 124
SmoI CTYRAG 1 cut(s) 124
Sse9I AATT 2 cut(s) 12, 109
SspMI CTAG 2 cut(s) 54, 63
TasI AATT 2 cut(s) 12, 109
TspDTI ATGAA 1 cut(s) 95
XspI CTAG 2 cut(s) 54, 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.