Rroxscaffold_7G00203680

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
52578658 .. 52579071
414 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00203680.1

Sequence Viewer

Length: 168 bp
ATGCTAGCTTTAAACTCGCAGAAGCACATCATGAATCTGAAATACAAGATAGTTAAAAGCCAATGTCCACCTAGAACTGGTAGGGATCAGCATTCTGGGTCAGGTGATGGCTATGGTTTTGACCTACTAAAAATTCCTGTTTGCTTTCATATATTGGGAACTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.13

Weight (kDa)

9.45

Isoelectric Point (pI)

31.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 166
AclWI GGATC 1 cut(s) 93
AcsI RAATTY 1 cut(s) 132
AfiI CCNNNNNNNGG 1 cut(s) 77
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
AlwI GGATC 1 cut(s) 93
ApoI RAATTY 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 116
AsuNHI GCTAGC 1 cut(s) 4
BccI CCATC 1 cut(s) 101
BfaI CTAG 2 cut(s) 5, 72
BmtI GCTAGC 1 cut(s) 8
Bsc4I CCNNNNNNNGG 1 cut(s) 77
Bse1I ACTGG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 77
BseNI ACTGG 1 cut(s) 82
BslI CCNNNNNNNGG 1 cut(s) 77
BsmI GAATGC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 85
BspHI TCATGA 1 cut(s) 30
BspOI GCTAGC 1 cut(s) 8
BspPI GGATC 1 cut(s) 93
BsrI ACTGG 1 cut(s) 82
BssMI GATC 1 cut(s) 85
BstC8I GCNNGC 1 cut(s) 6
BstKTI GATC 1 cut(s) 88
BstMBI GATC 1 cut(s) 85
Cac8I GCNNGC 1 cut(s) 6
CciI TCATGA 1 cut(s) 30
CviAII CATG 1 cut(s) 31
CviJI RGCY 3 cut(s) 8, 60, 111
CviKI_1 RGCY 3 cut(s) 8, 60, 111
DpnI GATC 1 cut(s) 87
DpnII GATC 1 cut(s) 85
DraI TTTAAA 1 cut(s) 12
FaeI CATG 1 cut(s) 34
FaiI YATR 5 cut(s) 32, 114, 150, 152, 166
FatI CATG 1 cut(s) 30
FspBI CTAG 2 cut(s) 5, 72
Hin1II CATG 1 cut(s) 34
HinfI GANTC 1 cut(s) 34
HphI GGTGA 1 cut(s) 116
Hpy166II GTNNAC 1 cut(s) 68
Hpy188I TCNGA 1 cut(s) 39
Hpy188III TCNNGA 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 68
Hsp92II CATG 1 cut(s) 34
Kzo9I GATC 1 cut(s) 85
LpnPI CCDG 4 cut(s) 63, 81, 87, 150
MaeI CTAG 2 cut(s) 5, 72
MalI GATC 1 cut(s) 87
MboI GATC 1 cut(s) 85
MluCI AATT 1 cut(s) 132
MseI TTAA 2 cut(s) 11, 54
Mva1269I GAATGC 1 cut(s) 91
NdeII GATC 1 cut(s) 85
NheI GCTAGC 1 cut(s) 4
NlaIII CATG 1 cut(s) 34
PagI TCATGA 1 cut(s) 30
PctI GAATGC 1 cut(s) 91
PfeI GAWTC 1 cut(s) 34
PsiI TTATAA 1 cut(s) 166
SaqAI TTAA 2 cut(s) 11, 54
Sau3AI GATC 1 cut(s) 85
SetI ASST 4 cut(s) 10, 73, 106, 126
SgeI CNNG 9 cut(s) 17, 28, 43, 58, 84, 90, 108, 114, 149
Sse9I AATT 1 cut(s) 132
SspMI CTAG 2 cut(s) 5, 72
TasI AATT 1 cut(s) 132
TfiI GAWTC 1 cut(s) 34
Tru1I TTAA 2 cut(s) 11, 54
Tru9I TTAA 2 cut(s) 11, 54
TspDTI ATGAA 2 cut(s) 47, 137
XapI RAATTY 1 cut(s) 132
XspI CTAG 2 cut(s) 5, 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.