Rroxscaffold_7G00209180

Disease resistance protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
59458727 .. 59463086
4360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00209180.1

Sequence Viewer

Length: 402 bp
ATGCTTGATCTTAGTTGGAGTCGGTACATTAAGAGAATTCTATCCACTTTGATATCAAGGTTGTCTAGGTTGTATAGTTCTTCCATTCAAGATAGTTTTCAGGACTGGGAGAGTAAGGTTGAGCGAGAAGGAGAAGAAACCAATGTTAGATTAATTGATGATTTGATTAGCCTGAGTCGGTCCATTAAGCGAATTCCATCCAATTTGATATCAAGGTTGTCTAGGTTAGAAGAAATGTACATGCAAGATAGTTTTAAGGACTGGGGGAGTAAAGTTGAGCGAGAAGGAGAAGAAACCAATGTTGGATTTGATGAGTTAATTTGCTTGTCATACTTGAACATTTTGGAAGTTGACATAATCGATGCAAAGTGCTTGCCTGAGAATGTTAGCTTCAAAAGTTAA

Protein Analysis

133

Amino Acids

15.56

Weight (kDa)

4.79

Isoelectric Point (pI)

52.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 36, 192
AfaI GTAC 2 cut(s) 26, 239
AgsI TTSAA 3 cut(s) 89, 337, 394
AjuI GAANNNNNNNTTGG 2 cut(s) 285, 317
AluBI AGCT 1 cut(s) 390
AluI AGCT 1 cut(s) 390
ApoI RAATTY 2 cut(s) 36, 192
AseI ATTAAT 1 cut(s) 152
AspS9I GGNCC 1 cut(s) 180
AvaII GGWCC 1 cut(s) 180
BccI CCATC 1 cut(s) 205
BfaI CTAG 2 cut(s) 66, 222
Bme18I GGWCC 1 cut(s) 180
BmgT120I GGNCC 1 cut(s) 180
BmrI ACTGGG 2 cut(s) 115, 271
BmsI GCATC 1 cut(s) 352
BmuI ACTGGG 2 cut(s) 115, 271
Bsa29I ATCGAT 1 cut(s) 360
Bse1I ACTGG 2 cut(s) 110, 266
BseCI ATCGAT 1 cut(s) 360
BseGI GGATG 1 cut(s) 197
BseMII CTCAG 2 cut(s) 164, 369
BseNI ACTGG 2 cut(s) 110, 266
BshVI ATCGAT 1 cut(s) 360
Bsp1407I TGTACA 1 cut(s) 237
Bsp143I GATC 1 cut(s) 7
BspCNI CTCAG 2 cut(s) 165, 370
BspDI ATCGAT 1 cut(s) 360
BsrGI TGTACA 1 cut(s) 237
BsrI ACTGG 2 cut(s) 110, 266
BssMI GATC 1 cut(s) 7
BstAUI TGTACA 1 cut(s) 237
BstC8I GCNNGC 1 cut(s) 374
BstDEI CTNAG 3 cut(s) 11, 173, 378
BstF5I GGATG 1 cut(s) 197
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BstNSI RCATGY 1 cut(s) 244
Bsu15I ATCGAT 1 cut(s) 360
BsuTUI ATCGAT 1 cut(s) 360
BtsCI GGATG 1 cut(s) 197
Cac8I GCNNGC 1 cut(s) 374
Cfr13I GGNCC 1 cut(s) 180
ClaI ATCGAT 1 cut(s) 360
Csp6I GTAC 2 cut(s) 25, 238
CviAII CATG 1 cut(s) 241
CviJI RGCY 2 cut(s) 171, 390
CviKI_1 RGCY 2 cut(s) 171, 390
CviQI GTAC 2 cut(s) 25, 238
DdeI CTNAG 3 cut(s) 11, 173, 378
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eco32I GATATC 2 cut(s) 54, 210
Eco47I GGWCC 1 cut(s) 180
EcoRI GAATTC 2 cut(s) 36, 192
EcoRV GATATC 2 cut(s) 54, 210
FaeI CATG 1 cut(s) 244
FaiI YATR 4 cut(s) 75, 242, 331, 356
FatI CATG 1 cut(s) 240
FokI GGATG 1 cut(s) 184
FspBI CTAG 2 cut(s) 66, 222
Hin1II CATG 1 cut(s) 244
HincII GTYRAC 1 cut(s) 352
HindII GTYRAC 1 cut(s) 352
HinfI GANTC 2 cut(s) 19, 175
Hpy166II GTNNAC 1 cut(s) 352
Hpy188III TCNNGA 2 cut(s) 89, 101
Hpy8I GTNNAC 1 cut(s) 352
HpyAV CCTTC 2 cut(s) 122, 278
HpyCH4V TGCA 2 cut(s) 244, 365
HpyF3I CTNAG 3 cut(s) 11, 173, 378
Hsp92II CATG 1 cut(s) 244
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 5 cut(s) 86, 91, 185, 247, 390
LweI GCATC 1 cut(s) 352
MaeI CTAG 2 cut(s) 66, 222
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 4 cut(s) 72, 146, 242, 302
MluCI AATT 5 cut(s) 36, 153, 192, 202, 318
MlyI GAGTC 2 cut(s) 28, 184
MmeI TCCRAC 1 cut(s) 283
MseI TTAA 6 cut(s) 30, 152, 186, 255, 317, 400
NdeII GATC 1 cut(s) 7
NlaIII CATG 1 cut(s) 244
NspI RCATGY 1 cut(s) 244
PleI GAGTC 2 cut(s) 27, 183
PpsI GAGTC 2 cut(s) 27, 183
PshBI ATTAAT 1 cut(s) 152
PspPI GGNCC 1 cut(s) 180
RsaI GTAC 2 cut(s) 26, 239
RsaNI GTAC 2 cut(s) 25, 238
SaqAI TTAA 6 cut(s) 30, 152, 186, 255, 317, 400
Sau3AI GATC 1 cut(s) 7
Sau96I GGNCC 1 cut(s) 180
SchI GAGTC 2 cut(s) 28, 184
SetI ASST 6 cut(s) 62, 71, 120, 218, 227, 392
SfaNI GCATC 1 cut(s) 352
SinI GGWCC 1 cut(s) 180
Sse9I AATT 5 cut(s) 36, 153, 192, 202, 318
SspMI CTAG 2 cut(s) 66, 222
TaqI TCGA 1 cut(s) 360
TaqII GACCGA 1 cut(s) 168
TasI AATT 5 cut(s) 36, 153, 192, 202, 318
TatI WGTACW 1 cut(s) 237
Tru1I TTAA 6 cut(s) 30, 152, 186, 255, 317, 400
Tru9I TTAA 6 cut(s) 30, 152, 186, 255, 317, 400
VpaK11BI GGWCC 1 cut(s) 180
VspI ATTAAT 1 cut(s) 152
XapI RAATTY 2 cut(s) 36, 192
XceI RCATGY 1 cut(s) 244
XspI CTAG 2 cut(s) 66, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.