Rorug01G0130000

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0014793
Physical Location & Seq
Forward (+)
22081185 .. 22084165
2981 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0130000.1

Sequence Viewer

Length: 165 bp
ATGACTTGCTATGAGATTTTGGCAACTGGAAAGCCTTCCATTCTGATACAGTCACCCGATGTTGCTGAAGGACATCAATTTAAAAATGCTTCTTTGTTGGCAGGGAGTGCCAAAATGGAAGAGAGGGTGAAGGAGGGAACTGAAAACATCTTCCCTTGGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2

Protein Analysis

54

Amino Acids

5.98

Weight (kDa)

5.13

Isoelectric Point (pI)

53.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_tran_28_C PF04101 1 - 35 5.5e-07 Glycosyltransferase family 28 C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014793)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g07400
malus_domestica MD02G1240700.v1.1 MD07G1076300.v1.1
prunus_persica Prupe.2G097100_v2.0.a1
pyrus_communis pycom02g20580 pycom07g06010
rosa_chinensis RchiOBHm_Chr1g0337001
rosa_laevigata RLG00000029313
rosa_multiflora Rmu_sc0009742.1_g000003
rosa_roxburghii Rroxscaffold_4G00315060
rosa_rugosa Rorug01G0129900 Rorug01G0130000 Rorug01G0130200
rosa_samantha Rh1AG150700 Rh1BG119100 Rh1CG141900
rosa_wichuraiana Rw1G012320

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 87
Asp700I GAANNNNTTC 1 cut(s) 34
AsuHPI GGTGA 2 cut(s) 45, 139
BsaJI CCNNGG 1 cut(s) 155
Bse1I ACTGG 1 cut(s) 31
BseDI CCNNGG 1 cut(s) 155
BseNI ACTGG 1 cut(s) 31
BsrI ACTGG 1 cut(s) 31
BssECI CCNNGG 1 cut(s) 155
BssT1I CCWWGG 1 cut(s) 155
Bst4CI ACNGT 1 cut(s) 51
Bst6I CTCTTC 1 cut(s) 114
BstAPI GCANNNNNTGC 1 cut(s) 107
BstMWI GCNNNNNNNGC 1 cut(s) 107
CviJI RGCY 1 cut(s) 34
CviKI_1 RGCY 1 cut(s) 34
DraI TTTAAA 1 cut(s) 82
Eam1104I CTCTTC 1 cut(s) 114
EarI CTCTTC 1 cut(s) 114
Eco130I CCWWGG 1 cut(s) 155
Eco57I CTGAAG 1 cut(s) 87
EcoT14I CCWWGG 1 cut(s) 155
ErhI CCWWGG 1 cut(s) 155
FaiI YATR 1 cut(s) 12
HphI GGTGA 2 cut(s) 45, 139
Hpy188I TCNGA 1 cut(s) 45
HpyAV CCTTC 3 cut(s) 45, 62, 124
HpyCH4III ACNGT 1 cut(s) 51
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
LpnPI CCDG 2 cut(s) 12, 87
MaeIII GTNAC 1 cut(s) 51
MboII GAAGA 2 cut(s) 131, 142
MluCI AATT 1 cut(s) 77
MnlI CCTC 2 cut(s) 117, 127
MroXI GAANNNNTTC 1 cut(s) 34
MseI TTAA 2 cut(s) 81, 163
MwoI GCNNNNNNNGC 1 cut(s) 107
NmuCI GTSAC 1 cut(s) 51
PdmI GAANNNNTTC 1 cut(s) 34
SaqAI TTAA 2 cut(s) 81, 163
SgeI CNNG 4 cut(s) 18, 39, 68, 114
Sse9I AATT 1 cut(s) 77
StyI CCWWGG 1 cut(s) 155
TaaI ACNGT 1 cut(s) 51
TasI AATT 1 cut(s) 77
Tru1I TTAA 2 cut(s) 81, 163
Tru9I TTAA 2 cut(s) 81, 163
TseFI GTSAC 1 cut(s) 51
Tsp45I GTSAC 1 cut(s) 51
XmnI GAANNNNTTC 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.