Rorug01G0250900

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Forward (+)
35899478 .. 35900405
928 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0250900.1

Sequence Viewer

Length: 198 bp
ATGGTGCATATCTTGAATTCTGTTTTAAAAGACAGGACAGAAGCAGTGCCAGATACAACACTTGGAGGGGCTACACAACATGGTAGATGGACAAAGTCAGCCTCATATGGAGGAATTAAATTTGATCGACATCAGAGAGAAGATTTATCAGTGGGAACTTCCAACAATCTGAAGAGTCGGATTGCTATGGGCATGTGA

Protein Analysis

65

Amino Acids

7.14

Weight (kDa)

9.81

Isoelectric Point (pI)

27.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 16, 119
AcuI CTGAAG 1 cut(s) 191
AgsI TTSAA 1 cut(s) 16
ApoI RAATTY 2 cut(s) 16, 119
BccI CCATC 1 cut(s) 81
BsaBI GATNNNNATC 1 cut(s) 129
Bse8I GATNNNNATC 1 cut(s) 129
BseJI GATNNNNATC 1 cut(s) 129
Bsp143I GATC 1 cut(s) 124
BssMI GATC 1 cut(s) 124
Bst6I CTCTTC 1 cut(s) 167
BstKTI GATC 1 cut(s) 127
BstMBI GATC 1 cut(s) 124
BstNSI RCATGY 1 cut(s) 196
BtsI GCAGTG 1 cut(s) 51
BtsIMutI CAGTG 2 cut(s) 51, 156
CviAII CATG 2 cut(s) 80, 193
CviJI RGCY 2 cut(s) 71, 101
CviKI_1 RGCY 2 cut(s) 71, 101
DpnI GATC 1 cut(s) 126
DpnII GATC 1 cut(s) 124
DraI TTTAAA 1 cut(s) 27
Eam1104I CTCTTC 1 cut(s) 167
EarI CTCTTC 1 cut(s) 167
Eco57I CTGAAG 1 cut(s) 191
EcoRI GAATTC 1 cut(s) 16
FaeI CATG 2 cut(s) 83, 196
FaiI YATR 6 cut(s) 9, 81, 106, 108, 188, 194
FatI CATG 2 cut(s) 79, 192
FauNDI CATATG 1 cut(s) 106
Hin1II CATG 2 cut(s) 83, 196
HinfI GANTC 1 cut(s) 175
Hpy188I TCNGA 3 cut(s) 135, 171, 180
Hpy188III TCNNGA 1 cut(s) 13
HpyCH4V TGCA 1 cut(s) 7
Hsp92II CATG 2 cut(s) 83, 196
Kzo9I GATC 1 cut(s) 124
LpnPI CCDG 2 cut(s) 19, 63
MalI GATC 1 cut(s) 126
MboI GATC 1 cut(s) 124
MboII GAAGA 2 cut(s) 152, 184
MluCI AATT 3 cut(s) 16, 114, 119
MlyI GAGTC 1 cut(s) 184
MmeI TCCRAC 2 cut(s) 158, 186
MnlI CCTC 3 cut(s) 59, 104, 112
MseI TTAA 2 cut(s) 26, 117
NdeI CATATG 1 cut(s) 106
NdeII GATC 1 cut(s) 124
NlaIII CATG 2 cut(s) 83, 196
NspI RCATGY 1 cut(s) 196
PflFI GACNNNGTC 1 cut(s) 94
PleI GAGTC 1 cut(s) 183
PpsI GAGTC 1 cut(s) 183
PsyI GACNNNGTC 1 cut(s) 94
SaqAI TTAA 2 cut(s) 26, 117
Sau3AI GATC 1 cut(s) 124
SchI GAGTC 1 cut(s) 184
SgeI CNNG 5 cut(s) 25, 46, 62, 74, 92
Sse9I AATT 3 cut(s) 16, 114, 119
TaqI TCGA 1 cut(s) 127
TasI AATT 3 cut(s) 16, 114, 119
Tru1I TTAA 2 cut(s) 26, 117
Tru9I TTAA 2 cut(s) 26, 117
TscAI CASTG 2 cut(s) 51, 156
TspRI CASTG 2 cut(s) 51, 156
Tth111I GACNNNGTC 1 cut(s) 94
XapI RAATTY 2 cut(s) 16, 119
XceI RCATGY 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.