Rorug01G0441500

SWR1 complex subunit

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
53897649 .. 53899611
1963 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0441500.1

Sequence Viewer

Length: 579 bp
ATGAGAATTCCAAGGTATCATCCAGACAAGAATACAAGCAATCCGGAAGCAACAGAACAGTTCGAGGAGGTTGCATTTTTGTATGGCATCTTATCTGACCCAGAAAAGATGAGGCATTATGACAATGCTGGTTACATGATCAGTTACTTACTGACTTTGACAGTTACATGGTCAGTTACTTCACTGGCTAGTGACTTGATCAGTGACATGTATAACAAGGACATAGTCAGTGACATGCAATGTGATTTGGCTAGTAACTTGTTACATGGTCAGTTACTTACTGAAGATTATCAGTTACTTACTGACTTTGACAGTTACATGGTCATTACTTCACTGGCTAGTGACTTGATCAGTGACGTGAATAACAAGGACATAGTCAGTGACATGCAATGTGATTTGGCTAGTAACTTGTCACTGGTCAACTCACTGTTACACATGTCACTAACCAAGTCACTGGCCATGTCACAGGCCAATGAAGTCATTAGCCAGCCCAAGTCCTTAATTAGTGAGGTCACTAAGCAAGTCAATGTTAACCTCAAGTCACTGGTTATGTCACTGGGCAAGTCACTGATCATGTAA

Protein Analysis

192

Amino Acids

21.47

Weight (kDa)

4.49

Isoelectric Point (pI)

37.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 5 - 41 4.7e-11 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 43
AcoI YGGCCR 1 cut(s) 456
AcsI RAATTY 1 cut(s) 6
AcuI CTGAAG 1 cut(s) 303
AflIII ACRYGT 2 cut(s) 207, 435
AjiI CACGTC 1 cut(s) 358
Aor13HI TCCGGA 1 cut(s) 43
AoxI GGCC 2 cut(s) 456, 468
ApoI RAATTY 1 cut(s) 6
BalI TGGCCA 1 cut(s) 458
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BclI TGATCA 4 cut(s) 138, 198, 348, 570
BfaI CTAG 4 cut(s) 189, 252, 339, 402
BmgBI CACGTC 1 cut(s) 358
BmrI ACTGGG 1 cut(s) 566
BmsI GCATC 1 cut(s) 96
BmuI ACTGGG 1 cut(s) 566
BpuEI CTTGAG 1 cut(s) 521
BsaJI CCNNGG 1 cut(s) 11
BsaWI WCCGGW 1 cut(s) 43
Bse1I ACTGG 6 cut(s) 189, 339, 420, 459, 549, 561
Bse3DI GCAATG 2 cut(s) 245, 395
BseAI TCCGGA 1 cut(s) 43
BseDI CCNNGG 1 cut(s) 11
BseGI GGATG 1 cut(s) 19
BseMI GCAATG 2 cut(s) 245, 395
BseNI ACTGG 6 cut(s) 189, 339, 420, 459, 549, 561
BseRI GAGGAG 1 cut(s) 80
BshFI GGCC 2 cut(s) 458, 470
BsiSI CCGG 1 cut(s) 44
BsnI GGCC 2 cut(s) 458, 470
Bsp13I TCCGGA 1 cut(s) 43
Bsp143I GATC 4 cut(s) 138, 198, 348, 570
BspANI GGCC 2 cut(s) 458, 470
BspEI TCCGGA 1 cut(s) 43
BsrDI GCAATG 2 cut(s) 245, 395
BsrI ACTGG 6 cut(s) 189, 339, 420, 459, 549, 561
BssECI CCNNGG 1 cut(s) 11
BssMI GATC 4 cut(s) 138, 198, 348, 570
BssT1I CCWWGG 1 cut(s) 11
Bst4CI ACNGT 4 cut(s) 60, 163, 314, 429
BstC8I GCNNGC 1 cut(s) 488
BstDEI CTNAG 1 cut(s) 516
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 4 cut(s) 141, 201, 351, 573
BstMBI GATC 4 cut(s) 138, 198, 348, 570
BstNSI RCATGY 4 cut(s) 211, 238, 388, 439
BstXI CCANNNNNNTGG 1 cut(s) 454
BsuRI GGCC 2 cut(s) 458, 470
BtrI CACGTC 1 cut(s) 358
BtsCI GGATG 1 cut(s) 19
Cac8I GCNNGC 1 cut(s) 488
CviJI RGCY 8 cut(s) 188, 251, 338, 401, 458, 470, 486, 490
CviKI_1 RGCY 8 cut(s) 188, 251, 338, 401, 458, 470, 486, 490
DdeI CTNAG 1 cut(s) 516
DpnI GATC 4 cut(s) 140, 200, 350, 572
DpnII GATC 4 cut(s) 138, 198, 348, 570
EaeI YGGCCR 1 cut(s) 456
Eco130I CCWWGG 1 cut(s) 11
Eco57I CTGAAG 1 cut(s) 303
EcoRI GAATTC 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 11
ErhI CCWWGG 1 cut(s) 11
FbaI TGATCA 4 cut(s) 138, 198, 348, 570
FokI GGATG 1 cut(s) 6
FspBI CTAG 4 cut(s) 189, 252, 339, 402
HaeIII GGCC 2 cut(s) 458, 470
HapII CCGG 1 cut(s) 44
HincII GTYRAC 2 cut(s) 421, 532
HindII GTYRAC 2 cut(s) 421, 532
HpaI GTTAAC 1 cut(s) 532
HpaII CCGG 1 cut(s) 44
Hpy166II GTNNAC 2 cut(s) 421, 532
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 2 cut(s) 23, 44
Hpy8I GTNNAC 2 cut(s) 421, 532
HpyCH4III ACNGT 4 cut(s) 60, 163, 314, 429
HpyCH4IV ACGT 1 cut(s) 357
HpyCH4V TGCA 3 cut(s) 74, 238, 388
HpyF3I CTNAG 1 cut(s) 516
HpySE526I ACGT 1 cut(s) 357
Kpn2I TCCGGA 1 cut(s) 43
Ksp22I TGATCA 4 cut(s) 138, 198, 348, 570
KspAI GTTAAC 1 cut(s) 532
Kzo9I GATC 4 cut(s) 138, 198, 348, 570
LweI GCATC 1 cut(s) 96
MaeI CTAG 4 cut(s) 189, 252, 339, 402
MaeII ACGT 1 cut(s) 357
MalI GATC 4 cut(s) 140, 200, 350, 572
MboI GATC 4 cut(s) 138, 198, 348, 570
MboII GAAGA 1 cut(s) 296
MlsI TGGCCA 1 cut(s) 458
MluCI AATT 2 cut(s) 6, 501
MluNI TGGCCA 1 cut(s) 458
MnlI CCTC 5 cut(s) 58, 61, 105, 502, 545
Mox20I TGGCCA 1 cut(s) 458
MroI TCCGGA 1 cut(s) 43
MscI TGGCCA 1 cut(s) 458
MseI TTAA 2 cut(s) 500, 531
Msp20I TGGCCA 1 cut(s) 458
MspI CCGG 1 cut(s) 44
NdeII GATC 4 cut(s) 138, 198, 348, 570
NspI RCATGY 4 cut(s) 211, 238, 388, 439
PciI ACATGT 2 cut(s) 207, 435
PflFI GACNNNGTC 2 cut(s) 224, 374
PscI ACATGT 2 cut(s) 207, 435
PsyI GACNNNGTC 2 cut(s) 224, 374
SaqAI TTAA 2 cut(s) 500, 531
Sau3AI GATC 4 cut(s) 138, 198, 348, 570
SetI ASST 5 cut(s) 17, 72, 360, 513, 537
SfaNI GCATC 1 cut(s) 96
SmlI CTYRAG 1 cut(s) 536
SmoI CTYRAG 1 cut(s) 536
Sse9I AATT 2 cut(s) 6, 501
SspMI CTAG 4 cut(s) 189, 252, 339, 402
StyI CCWWGG 1 cut(s) 11
TaaI ACNGT 4 cut(s) 60, 163, 314, 429
TaiI ACGT 1 cut(s) 360
TaqI TCGA 1 cut(s) 63
TasI AATT 2 cut(s) 6, 501
Tru1I TTAA 2 cut(s) 500, 531
Tru9I TTAA 2 cut(s) 500, 531
TspDTI ATGAA 1 cut(s) 489
Tth111I GACNNNGTC 2 cut(s) 224, 374
XapI RAATTY 1 cut(s) 6
XceI RCATGY 4 cut(s) 211, 238, 388, 439
XspI CTAG 4 cut(s) 189, 252, 339, 402
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.