Rorug01G0445500

Transcription factor-like protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
54167511 .. 54167666
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0445500.1

Sequence Viewer

Length: 156 bp
ATGCTTGGAGGAGAACAAGGGCGACTACGTCAAGTGCCAATCACAGATCGATGCCTTCAAGTCTTCTTGTGCTGTGAAGAAACCAAGCCCATCCGTAGAGTCTGTACCTTAAGATCAATTTTGATTTTGATGTTCATCTTTCACTTACTTGAATAA

Protein Analysis

51

Amino Acids

5.99

Weight (kDa)

8.52

Isoelectric Point (pI)

74.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 106
AflII CTTAAG 1 cut(s) 109
AgsI TTSAA 2 cut(s) 59, 152
BbsI GAAGAC 1 cut(s) 55
BccI CCATC 1 cut(s) 98
BfrI CTTAAG 1 cut(s) 109
BmsI GCATC 1 cut(s) 41
BpiI GAAGAC 1 cut(s) 55
Bsa29I ATCGAT 1 cut(s) 49
BsaBI GATNNNNATC 1 cut(s) 134
Bse8I GATNNNNATC 1 cut(s) 134
BseCI ATCGAT 1 cut(s) 49
BseGI GGATG 1 cut(s) 90
BseJI GATNNNNATC 1 cut(s) 134
BseRI GAGGAG 1 cut(s) 24
BshVI ATCGAT 1 cut(s) 49
Bsp143I GATC 2 cut(s) 46, 113
BspDI ATCGAT 1 cut(s) 49
BspTI CTTAAG 1 cut(s) 109
BssMI GATC 2 cut(s) 46, 113
BstAFI CTTAAG 1 cut(s) 109
BstF5I GGATG 1 cut(s) 90
BstKTI GATC 2 cut(s) 49, 116
BstMBI GATC 2 cut(s) 46, 113
BstV2I GAAGAC 1 cut(s) 55
Bsu15I ATCGAT 1 cut(s) 49
BsuTUI ATCGAT 1 cut(s) 49
BtsCI GGATG 1 cut(s) 90
ClaI ATCGAT 1 cut(s) 49
Csp6I GTAC 1 cut(s) 105
CviJI RGCY 1 cut(s) 88
CviKI_1 RGCY 1 cut(s) 88
CviQI GTAC 1 cut(s) 105
DpnI GATC 2 cut(s) 48, 115
DpnII GATC 2 cut(s) 46, 113
FokI GGATG 1 cut(s) 77
FspEI CC 9 cut(s) 3, 4, 51, 68, 97, 102, 103, 107, 121
HinfI GANTC 1 cut(s) 99
HpyAV CCTTC 1 cut(s) 65
HpyCH4IV ACGT 1 cut(s) 28
HpySE526I ACGT 1 cut(s) 28
Kzo9I GATC 2 cut(s) 46, 113
LweI GCATC 1 cut(s) 41
MaeII ACGT 1 cut(s) 28
MalI GATC 2 cut(s) 48, 115
MboI GATC 2 cut(s) 46, 113
MboII GAAGA 2 cut(s) 55, 89
MluCI AATT 1 cut(s) 117
MlyI GAGTC 1 cut(s) 108
MseI TTAA 1 cut(s) 110
MspCI CTTAAG 1 cut(s) 109
NdeII GATC 2 cut(s) 46, 113
PflFI GACNNNGTC 1 cut(s) 27
PleI GAGTC 1 cut(s) 107
PpsI GAGTC 1 cut(s) 107
PsyI GACNNNGTC 1 cut(s) 27
RsaI GTAC 1 cut(s) 106
RsaNI GTAC 1 cut(s) 105
SaqAI TTAA 1 cut(s) 110
Sau3AI GATC 2 cut(s) 46, 113
SchI GAGTC 1 cut(s) 108
SetI ASST 2 cut(s) 31, 110
SfaNI GCATC 1 cut(s) 41
SgeI CNNG 6 cut(s) 17, 29, 44, 71, 79, 97
SmlI CTYRAG 1 cut(s) 109
SmoI CTYRAG 1 cut(s) 109
Sse9I AATT 1 cut(s) 117
TaiI ACGT 1 cut(s) 31
TaqI TCGA 1 cut(s) 49
TasI AATT 1 cut(s) 117
Tru1I TTAA 1 cut(s) 110
Tru9I TTAA 1 cut(s) 110
TspDTI ATGAA 1 cut(s) 124
TspGWI ACGGA 1 cut(s) 83
Tth111I GACNNNGTC 1 cut(s) 27
Vha464I CTTAAG 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.