Rorug02G0255600

protein disulfide oxidoreductase activity

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
26751486 .. 26751879
394 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0255600.1

Sequence Viewer

Length: 228 bp
ATGGCAAATATTCCAAAAGACATTCCTCTTTTCCTCGGCTATGGAGGGAGAGATACACTTTTGGACGGCAACAATGTGAAGCTTTTGCTTAATGACATCAAAGATCATGACAAGGACAAGCTTGTGGAACAATACGTAGAGGAGTATGCTCATATGGATTTCTTTATGGGTTGGAATGCCAAACATAAAGTTTATGATTCTCTCCTCACTTTCTTCGGGCAACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.74

Weight (kDa)

5.35

Isoelectric Point (pI)

25.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016640)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G41330 AT3G57070
malus_domestica MD14G1084700.v1.1
prunus_persica Prupe.7G043200_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0125081
rosa_laevigata RLG00000018848
rosa_multiflora Rmu_sc0003505.1_g000023 Rmu_sc0003505.1_g000024
rosa_roxburghii Rroxscaffold_2G00118710
rosa_rugosa Rorug02G0255600
rosa_samantha Rh2AG314000 Rh2BG322300 Rh2DG340700
rosa_wichuraiana Rw2G025410

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 82, 121
AluI AGCT 2 cut(s) 82, 121
BceAI ACGGC 1 cut(s) 82
BsaAI YACGTR 1 cut(s) 136
BsaJI CCNNGG 1 cut(s) 34
BseDI CCNNGG 1 cut(s) 34
BseRI GAGGAG 2 cut(s) 155, 194
BsmI GAATGC 1 cut(s) 181
Bsp143I GATC 1 cut(s) 103
BspHI TCATGA 1 cut(s) 106
BssECI CCNNGG 1 cut(s) 34
BssMI GATC 1 cut(s) 103
BstBAI YACGTR 1 cut(s) 136
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstSNI TACGTA 1 cut(s) 136
CciI TCATGA 1 cut(s) 106
CviAII CATG 1 cut(s) 107
CviJI RGCY 3 cut(s) 39, 82, 121
CviKI_1 RGCY 3 cut(s) 39, 82, 121
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
Eco105I TACGTA 1 cut(s) 136
FaeI CATG 1 cut(s) 110
FaiI YATR 8 cut(s) 42, 108, 147, 153, 155, 167, 186, 195
FatI CATG 1 cut(s) 106
FauNDI CATATG 1 cut(s) 153
Hin1II CATG 1 cut(s) 110
HindIII AAGCTT 2 cut(s) 80, 119
HinfI GANTC 1 cut(s) 197
Hpy188III TCNNGA 1 cut(s) 107
HpyCH4IV ACGT 1 cut(s) 135
HpySE526I ACGT 1 cut(s) 135
Hsp92II CATG 1 cut(s) 110
Kzo9I GATC 1 cut(s) 103
MaeII ACGT 1 cut(s) 135
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MboII GAAGA 1 cut(s) 205
MmeI TCCRAC 1 cut(s) 152
MnlI CCTC 5 cut(s) 36, 38, 44, 133, 215
MseI TTAA 1 cut(s) 90
Mva1269I GAATGC 1 cut(s) 181
NdeI CATATG 1 cut(s) 153
NdeII GATC 1 cut(s) 103
NlaIII CATG 1 cut(s) 110
NmeAIII GCCGAG 1 cut(s) 15
PagI TCATGA 1 cut(s) 106
PctI GAATGC 1 cut(s) 181
PfeI GAWTC 1 cut(s) 197
Ppu21I YACGTR 1 cut(s) 136
SaqAI TTAA 1 cut(s) 90
Sau3AI GATC 1 cut(s) 103
SetI ASST 3 cut(s) 84, 123, 138
SgeI CNNG 5 cut(s) 47, 119, 124, 130, 134
SnaBI TACGTA 1 cut(s) 136
SspI AATATT 1 cut(s) 10
TaiI ACGT 1 cut(s) 138
TfiI GAWTC 1 cut(s) 197
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.