Rorug02G0320200

Clustered mitochondria protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0004812
Physical Location & Seq
Forward (+)
39158851 .. 39159567
717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0320200.1

Sequence Viewer

Length: 294 bp
ATGAACCGCAACGCCTACAGAACGGCGCCGTATCCCACTCTGCCGGAAATGCAAGGACAGCCTGGACCCAGAAGGATTGAGCTGCCATTGGCTTTGAGCCAAGCGATGAACAGTGAGGGAAGCACCAAGCTTTATATATCTAACTTGGACTATGATGTTACCAATCGAGATATAGAGGAGTTTTACCAGACGACCCTCTATCCCCTGTTTCAAAAGAAATGGTGTCTTGCTTTTGATATGGTCACTGTAATCTGTGACCCTGAATCACCTGTCTGGGTTTTTAAAAGGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CLU_N TPR_12 eIF3_p135

Protein Analysis

97

Amino Acids

11.34

Weight (kDa)

6.2

Isoelectric Point (pI)

60.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 25
AciI CCGC 1 cut(s) 7
AcyI GRCGYC 1 cut(s) 26
AgsI TTSAA 1 cut(s) 212
AjnI CCWGG 1 cut(s) 61
AluBI AGCT 2 cut(s) 82, 130
AluI AGCT 2 cut(s) 82, 130
ApeKI GCWGC 1 cut(s) 82
AspLEI GCGC 1 cut(s) 28
AspS9I GGNCC 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 258
AvaII GGWCC 1 cut(s) 65
BanI GGYRCC 1 cut(s) 25
BbvI GCAGC 1 cut(s) 69
BceAI ACGGC 2 cut(s) 13, 39
BciT130I CCWGG 1 cut(s) 63
BciVI GTATCC 1 cut(s) 42
BfmI CTRYAG 1 cut(s) 16
BfoI RGCGCY 1 cut(s) 29
BfuI GTATCC 1 cut(s) 42
BisI GCNGC 1 cut(s) 83
BlsI GCNGC 1 cut(s) 84
Bme1390I CCNGG 1 cut(s) 63
Bme18I GGWCC 1 cut(s) 65
BmgT120I GGNCC 1 cut(s) 65
BmiI GGNNCC 2 cut(s) 27, 67
BmrFI CCNGG 1 cut(s) 63
BsaHI GRCGYC 1 cut(s) 26
BseBI CCWGG 1 cut(s) 63
BseRI GAGGAG 1 cut(s) 191
BseXI GCAGC 1 cut(s) 69
BshNI GGYRCC 1 cut(s) 25
BsiSI CCGG 1 cut(s) 44
BspACI CCGC 1 cut(s) 7
BspLI GGNNCC 2 cut(s) 27, 67
BspT107I GGYRCC 1 cut(s) 25
BssNI GRCGYC 1 cut(s) 26
Bst2UI CCWGG 1 cut(s) 63
Bst4CI ACNGT 2 cut(s) 113, 247
BstACI GRCGYC 1 cut(s) 26
BstH2I RGCGCY 1 cut(s) 29
BstHHI GCGC 1 cut(s) 28
BstMWI GCNNNNNNNGC 2 cut(s) 49, 58
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 16
BstV1I GCAGC 1 cut(s) 69
BsuI GTATCC 1 cut(s) 42
BtgZI GCGATG 1 cut(s) 119
BtsIMutI CAGTG 2 cut(s) 118, 243
CfoI GCGC 1 cut(s) 28
Cfr13I GGNCC 1 cut(s) 65
CviJI RGCY 5 cut(s) 61, 82, 92, 99, 130
CviKI_1 RGCY 5 cut(s) 61, 82, 92, 99, 130
DinI GGCGCC 1 cut(s) 27
DraI TTTAAA 1 cut(s) 283
Eco47I GGWCC 1 cut(s) 65
EcoRII CCWGG 1 cut(s) 61
EgeI GGCGCC 1 cut(s) 27
EheI GGCGCC 1 cut(s) 27
FaiI YATR 5 cut(s) 135, 137, 153, 173, 239
Fnu4HI GCNGC 1 cut(s) 83
Fsp4HI GCNGC 1 cut(s) 83
GlaI GCGC 1 cut(s) 27
GluI GCNGC 1 cut(s) 83
HaeII RGCGCY 1 cut(s) 29
HapII CCGG 1 cut(s) 44
HhaI GCGC 1 cut(s) 28
Hin1I GRCGYC 1 cut(s) 26
Hin6I GCGC 1 cut(s) 26
HinP1I GCGC 1 cut(s) 26
HindIII AAGCTT 1 cut(s) 128
HinfI GANTC 1 cut(s) 263
HpaII CCGG 1 cut(s) 44
HphI GGTGA 1 cut(s) 258
Hpy188III TCNNGA 1 cut(s) 167
HpyAV CCTTC 1 cut(s) 66
HpyCH4III ACNGT 2 cut(s) 113, 247
HpyCH4V TGCA 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 2 cut(s) 49, 58
Hsp92I GRCGYC 1 cut(s) 26
HspAI GCGC 1 cut(s) 26
KasI GGCGCC 1 cut(s) 25
LpnPI CCDG 9 cut(s) 48, 57, 75, 82, 200, 218, 259, 273, 282
Lsp1109I GCAGC 1 cut(s) 69
MaeIII GTNAC 3 cut(s) 157, 241, 254
Mly113I GGCGCC 1 cut(s) 26
MnlI CCTC 3 cut(s) 109, 169, 206
MseI TTAA 1 cut(s) 282
MspI CCGG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 63
MvaI CCWGG 1 cut(s) 63
MwoI GCNNNNNNNGC 2 cut(s) 49, 58
NarI GGCGCC 1 cut(s) 26
NlaIV GGNNCC 2 cut(s) 27, 67
NmuCI GTSAC 2 cut(s) 241, 254
PfeI GAWTC 1 cut(s) 263
PkrI GCNGC 1 cut(s) 84
PluTI GGCGCC 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
PspN4I GGNNCC 2 cut(s) 27, 67
PspPI GGNCC 1 cut(s) 65
SaqAI TTAA 1 cut(s) 282
SatI GCNGC 1 cut(s) 83
Sau96I GGNCC 1 cut(s) 65
ScrFI CCNGG 1 cut(s) 63
SetI ASST 3 cut(s) 84, 132, 271
SfcI CTRYAG 1 cut(s) 16
SfoI GGCGCC 1 cut(s) 27
SinI GGWCC 1 cut(s) 65
SsiI CCGC 1 cut(s) 7
SspDI GGCGCC 1 cut(s) 25
StyD4I CCNGG 1 cut(s) 61
TaaI ACNGT 2 cut(s) 113, 247
TaqI TCGA 1 cut(s) 166
TfiI GAWTC 1 cut(s) 263
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TscAI CASTG 2 cut(s) 118, 250
TseFI GTSAC 2 cut(s) 241, 254
TseI GCWGC 1 cut(s) 82
Tsp45I GTSAC 2 cut(s) 241, 254
TspDTI ATGAA 2 cut(s) 17, 122
TspRI CASTG 2 cut(s) 118, 250
VpaK11BI GGWCC 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.