Rorug02G0623300

low-specificity L-threonine aldolase 1

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
73967188 .. 73967962
775 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0623300.1

Sequence Viewer

Length: 369 bp
ATGGCTCGAAATAAGGATGCTACAGTTTTGGTGATTGATGTTGGTCCATCGATGCACAAAGCTCTTTCGGAAATGGAAAAGCTTTGTTCCATGCTAGTAGAGAAGAAGCTCATCCACTGCAAATATGATGAAGTAGGAGTTGTTTTAGGTGATCTTGAGCCGAGCCCCAAAATGAAGTCAAGGTATGGGTTCACAAGAAAACATCAGAAGGCAAGTTTCTTACTATACCATCTGCCAAACGGGGTGTGGTCAAGTTCCGAGCGGATCGAAAAGAGTGTGAAACTTGTGGGATTTGCTGATGCTCATCAAAACATAAGGCGACACTACTACATGAAAGATGTTGATATTTTCATTCCTGAACCGGGGTAA

Protein Analysis

122

Amino Acids

13.96

Weight (kDa)

9.08

Isoelectric Point (pI)

59.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 262
AciI CCGC 1 cut(s) 262
AclWI GGATC 1 cut(s) 272
AfiI CCNNNNNNNGG 1 cut(s) 362
AluBI AGCT 3 cut(s) 62, 82, 109
AluI AGCT 3 cut(s) 62, 82, 109
AlwI GGATC 1 cut(s) 272
AspS9I GGNCC 1 cut(s) 44
AsuC2I CCSGG 1 cut(s) 363
AsuHPI GGTGA 2 cut(s) 43, 161
AvaII GGWCC 1 cut(s) 44
BanII GRGCYC 1 cut(s) 167
BccI CCATC 2 cut(s) 55, 237
BcnI CCSGG 1 cut(s) 363
BfaI CTAG 1 cut(s) 95
BfmI CTRYAG 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 363
Bme18I GGWCC 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 44
BmrFI CCNGG 1 cut(s) 363
BmsI GCATC 3 cut(s) 7, 42, 289
BpuEI CTTGAG 1 cut(s) 176
BpuMI CCSGG 1 cut(s) 363
Bsa29I ATCGAT 1 cut(s) 50
BsaBI GATNNNNATC 1 cut(s) 303
BsaJI CCNNGG 1 cut(s) 362
Bsc4I CCNNNNNNNGG 1 cut(s) 362
Bse8I GATNNNNATC 1 cut(s) 303
BseCI ATCGAT 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 362
BseGI GGATG 2 cut(s) 22, 111
BseJI GATNNNNATC 1 cut(s) 303
BseLI CCNNNNNNNGG 1 cut(s) 362
BshVI ATCGAT 1 cut(s) 50
BsiSI CCGG 1 cut(s) 362
BslI CCNNNNNNNGG 1 cut(s) 362
Bsp1286I GDGCHC 1 cut(s) 167
Bsp143I GATC 2 cut(s) 151, 264
BspACI CCGC 1 cut(s) 262
BspDI ATCGAT 1 cut(s) 50
BspPI GGATC 1 cut(s) 272
BsrBI CCGCTC 1 cut(s) 262
BssECI CCNNGG 1 cut(s) 362
BssMI GATC 2 cut(s) 151, 264
Bst4CI ACNGT 1 cut(s) 25
BstF5I GGATG 2 cut(s) 22, 111
BstKTI GATC 2 cut(s) 154, 267
BstMBI GATC 2 cut(s) 151, 264
BstSCI CCNGG 1 cut(s) 361
BstSFI CTRYAG 1 cut(s) 21
Bsu15I ATCGAT 1 cut(s) 50
BsuTUI ATCGAT 1 cut(s) 50
BtsCI GGATG 2 cut(s) 22, 111
BtsI GCAGTG 1 cut(s) 115
BtsIMutI CAGTG 1 cut(s) 115
Cfr13I GGNCC 1 cut(s) 44
ClaI ATCGAT 1 cut(s) 50
CviAII CATG 2 cut(s) 91, 331
CviJI RGCY 6 cut(s) 5, 62, 82, 109, 160, 165
CviKI_1 RGCY 6 cut(s) 5, 62, 82, 109, 160, 165
DpnI GATC 2 cut(s) 153, 266
DpnII GATC 2 cut(s) 151, 264
Eco24I GRGCYC 1 cut(s) 167
Eco47I GGWCC 1 cut(s) 44
EcoT38I GRGCYC 1 cut(s) 167
FaeI CATG 2 cut(s) 94, 334
FaiI YATR 6 cut(s) 92, 126, 186, 226, 314, 332
FatI CATG 2 cut(s) 90, 330
FokI GGATG 2 cut(s) 29, 98
FriOI GRGCYC 1 cut(s) 167
FspBI CTAG 1 cut(s) 95
HapII CCGG 1 cut(s) 362
Hin1II CATG 2 cut(s) 94, 334
HindIII AAGCTT 1 cut(s) 80
HpaII CCGG 1 cut(s) 362
HphI GGTGA 2 cut(s) 43, 161
Hpy166II GTNNAC 1 cut(s) 192
Hpy188I TCNGA 3 cut(s) 70, 207, 259
Hpy188III TCNNGA 2 cut(s) 155, 356
Hpy8I GTNNAC 1 cut(s) 192
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 25
HpyCH4V TGCA 2 cut(s) 55, 120
Hsp92II CATG 2 cut(s) 94, 334
Kzo9I GATC 2 cut(s) 151, 264
LweI GCATC 3 cut(s) 7, 42, 289
MaeI CTAG 1 cut(s) 95
MalI GATC 2 cut(s) 153, 266
MbiI CCGCTC 1 cut(s) 262
MboI GATC 2 cut(s) 151, 264
MboII GAAGA 1 cut(s) 115
MhlI GDGCHC 1 cut(s) 167
MspI CCGG 1 cut(s) 362
MspR9I CCNGG 1 cut(s) 363
NciI CCSGG 1 cut(s) 363
NdeII GATC 2 cut(s) 151, 264
NlaIII CATG 2 cut(s) 94, 334
NmeAIII GCCGAG 1 cut(s) 186
PspPI GGNCC 1 cut(s) 44
Sau3AI GATC 2 cut(s) 151, 264
Sau96I GGNCC 1 cut(s) 44
ScrFI CCNGG 1 cut(s) 363
SduI GDGCHC 1 cut(s) 167
SetI ASST 5 cut(s) 64, 84, 111, 151, 185
SfaNI GCATC 3 cut(s) 7, 42, 289
SfcI CTRYAG 1 cut(s) 21
SinI GGWCC 1 cut(s) 44
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
SsiI CCGC 1 cut(s) 262
SspMI CTAG 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 361
TaaI ACNGT 1 cut(s) 25
TaqI TCGA 3 cut(s) 7, 50, 267
TscAI CASTG 1 cut(s) 122
TspDTI ATGAA 4 cut(s) 144, 188, 340, 347
TspRI CASTG 1 cut(s) 122
VpaK11BI GGWCC 1 cut(s) 44
XcmI CCANNNNNNNNNTGG 1 cut(s) 243
XspI CTAG 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.