Rorug03G0268100

4-alpha-glucanotransferase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
26307430 .. 26307606
177 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0268100.1

Sequence Viewer

Length: 177 bp
ATGATGGCAGATCTCCCATTTCCAGCGTCCCCTTGGACCACATACATCTGGATTATGATCCTAATTCATGGACTGCCACTAGCTTTTCTCACGCTGGCAATTGTATCATTGATAGGAGAAACGATTGGAACGGTACTAGAGGTGGATCGGCATGGCTTGCATGAGGGTCGAGCATAG

Protein Analysis

58

Amino Acids

6.4

Weight (kDa)

5.28

Isoelectric Point (pI)

28.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 52, 153
AfaI GTAC 1 cut(s) 135
AluBI AGCT 1 cut(s) 83
AluI AGCT 1 cut(s) 83
AlwI GGATC 2 cut(s) 52, 153
AspS9I GGNCC 1 cut(s) 36
AvaII GGWCC 1 cut(s) 36
BcgI CGANNNNNNTGC 1 cut(s) 149
BfaI CTAG 2 cut(s) 80, 137
BglII AGATCT 1 cut(s) 10
Bme18I GGWCC 1 cut(s) 36
BmgT120I GGNCC 1 cut(s) 36
BsaBI GATNNNNATC 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 32
Bse8I GATNNNNATC 1 cut(s) 56
BseDI CCNNGG 1 cut(s) 32
BseJI GATNNNNATC 1 cut(s) 56
BslFI GGGAC 1 cut(s) 13
BsmFI GGGAC 1 cut(s) 13
Bsp143I GATC 3 cut(s) 10, 57, 145
BspPI GGATC 2 cut(s) 52, 153
BssECI CCNNGG 1 cut(s) 32
BssMI GATC 3 cut(s) 10, 57, 145
BssT1I CCWWGG 1 cut(s) 32
Bst4CI ACNGT 1 cut(s) 133
BstAPI GCANNNNNTGC 1 cut(s) 157
BstC8I GCNNGC 2 cut(s) 96, 158
BstKTI GATC 3 cut(s) 13, 60, 148
BstMBI GATC 3 cut(s) 10, 57, 145
BstMWI GCNNNNNNNGC 1 cut(s) 157
BstX2I RGATCY 1 cut(s) 10
BstYI RGATCY 1 cut(s) 10
Cac8I GCNNGC 2 cut(s) 96, 158
Cfr13I GGNCC 1 cut(s) 36
CseI GACGC 1 cut(s) 15
Csp6I GTAC 1 cut(s) 134
CviAII CATG 3 cut(s) 68, 152, 161
CviJI RGCY 2 cut(s) 83, 156
CviKI_1 RGCY 2 cut(s) 83, 156
CviQI GTAC 1 cut(s) 134
DpnI GATC 3 cut(s) 12, 59, 147
DpnII GATC 3 cut(s) 10, 57, 145
Eco130I CCWWGG 1 cut(s) 32
Eco47I GGWCC 1 cut(s) 36
EcoT14I CCWWGG 1 cut(s) 32
ErhI CCWWGG 1 cut(s) 32
FaeI CATG 3 cut(s) 71, 155, 164
FaiI YATR 6 cut(s) 43, 56, 69, 153, 162, 175
FaqI GGGAC 1 cut(s) 13
FatI CATG 3 cut(s) 67, 151, 160
FspBI CTAG 2 cut(s) 80, 137
HgaI GACGC 1 cut(s) 15
Hin1II CATG 3 cut(s) 71, 155, 164
Hpy188III TCNNGA 1 cut(s) 49
HpyCH4III ACNGT 1 cut(s) 133
HpyCH4V TGCA 1 cut(s) 160
HpyF10VI GCNNNNNNNGC 1 cut(s) 157
Hsp92II CATG 3 cut(s) 71, 155, 164
Kzo9I GATC 3 cut(s) 10, 57, 145
LpnPI CCDG 3 cut(s) 34, 36, 80
MaeI CTAG 2 cut(s) 80, 137
MalI GATC 3 cut(s) 12, 59, 147
MboI GATC 3 cut(s) 10, 57, 145
MfeI CAATTG 1 cut(s) 99
MflI RGATCY 1 cut(s) 10
MluCI AATT 2 cut(s) 63, 99
MnlI CCTC 2 cut(s) 133, 157
MunI CAATTG 1 cut(s) 99
MwoI GCNNNNNNNGC 1 cut(s) 157
NdeII GATC 3 cut(s) 10, 57, 145
NlaIII CATG 3 cut(s) 71, 155, 164
PspPI GGNCC 1 cut(s) 36
PsuI RGATCY 1 cut(s) 10
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
Sau3AI GATC 3 cut(s) 10, 57, 145
Sau96I GGNCC 1 cut(s) 36
SetI ASST 2 cut(s) 85, 144
SinI GGWCC 1 cut(s) 36
Sse9I AATT 2 cut(s) 63, 99
SspMI CTAG 2 cut(s) 80, 137
StyI CCWWGG 1 cut(s) 32
TaaI ACNGT 1 cut(s) 133
TaqI TCGA 1 cut(s) 169
TasI AATT 2 cut(s) 63, 99
TspDTI ATGAA 1 cut(s) 56
VpaK11BI GGWCC 1 cut(s) 36
XcmI CCANNNNNNNNNTGG 1 cut(s) 30
XspI CTAG 2 cut(s) 80, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.