Rorug03G0353000

Surfeit locus protein 6

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
43326434 .. 43326604
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0353000.1

Sequence Viewer

Length: 171 bp
ATGACTTTTCGTGTATCTCATATTTTTCGTGAAGGTAATAAGGTAGCTGATGCTTTGGCGAATTATGGTACGACTGCTCCTAATATGGTGTGGTGGGATGCTCCACCATCTTTTCTTTTATCGCATTGTCAGAGTGACCAATTGGGTTTTCCCCAATTTCGGTTACGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.43

Weight (kDa)

8.0

Isoelectric Point (pI)

45.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 70
AfiI CCNNNNNNNGG 1 cut(s) 159
AjuI GAANNNNNNNTTGG 2 cut(s) 132, 164
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
BccI CCATC 1 cut(s) 115
BmsI GCATC 2 cut(s) 40, 88
BsaXI ACNNNNNCTCC 2 cut(s) 61, 91
Bsc4I CCNNNNNNNGG 1 cut(s) 159
BseGI GGATG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 159
BslI CCNNNNNNNGG 1 cut(s) 159
BstF5I GGATG 1 cut(s) 103
BtsCI GGATG 1 cut(s) 103
Csp6I GTAC 1 cut(s) 69
CviJI RGCY 1 cut(s) 47
CviKI_1 RGCY 1 cut(s) 47
CviQI GTAC 1 cut(s) 69
FaiI YATR 3 cut(s) 21, 66, 86
FokI GGATG 1 cut(s) 110
Hpy188I TCNGA 1 cut(s) 132
Hpy188III TCNNGA 1 cut(s) 29
HpyAV CCTTC 1 cut(s) 26
LmnI GCTCC 2 cut(s) 82, 106
LweI GCATC 2 cut(s) 40, 88
MaeIII GTNAC 2 cut(s) 134, 162
MfeI CAATTG 1 cut(s) 140
MluCI AATT 3 cut(s) 61, 140, 155
MunI CAATTG 1 cut(s) 140
NmuCI GTSAC 1 cut(s) 134
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
SetI ASST 3 cut(s) 37, 45, 49
SfaNI GCATC 2 cut(s) 40, 88
SgeI CNNG 2 cut(s) 23, 41
Sse9I AATT 3 cut(s) 61, 140, 155
TasI AATT 3 cut(s) 61, 140, 155
TseFI GTSAC 1 cut(s) 134
Tsp45I GTSAC 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.