Rorug05G0171700

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
16026586 .. 16027313
728 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0171700.1

Sequence Viewer

Length: 213 bp
ATGGTTCATAAGGCCTGTACTATTTACGTGGTGATTCCCTTGATCCTATTGTTATTCTTCTTCTCATCCAACGTCGTTTCTGCTGGAATTTCTTACATTCCAAAAACCAAAGAGAAAAGGAATCACCATGTGAATATGGATATTTTTAAAGGAAGGAAAATAGGCGTACCAGTACCTTCTACACCTGGAGATAGCCATGGTAACGTAGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.68

Weight (kDa)

9.81

Isoelectric Point (pI)

39.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011062)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 37
AcsI RAATTY 1 cut(s) 87
AdeI CACNNNGTG 1 cut(s) 130
AfaI GTAC 3 cut(s) 19, 168, 174
AjnI CCWGG 1 cut(s) 184
AlwI GGATC 1 cut(s) 37
AoxI GGCC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 87
AsuHPI GGTGA 2 cut(s) 43, 116
BciT130I CCWGG 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 186
BpmI CTGGAG 1 cut(s) 207
BsaAI YACGTR 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 196
Bse1I ACTGG 1 cut(s) 170
BseBI CCWGG 1 cut(s) 186
BseDI CCNNGG 1 cut(s) 196
BseGI GGATG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 170
BshFI GGCC 1 cut(s) 14
BsnI GGCC 1 cut(s) 14
Bsp143I GATC 1 cut(s) 42
Bsp19I CCATGG 1 cut(s) 196
BspANI GGCC 1 cut(s) 14
BspPI GGATC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 170
BssECI CCNNGG 1 cut(s) 196
BssMI GATC 1 cut(s) 42
BssT1I CCWWGG 1 cut(s) 196
Bst2UI CCWGG 1 cut(s) 186
BstBAI YACGTR 1 cut(s) 28
BstDSI CCRYGG 1 cut(s) 196
BstF5I GGATG 1 cut(s) 65
BstKTI GATC 1 cut(s) 45
BstMBI GATC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 186
BstSCI CCNGG 1 cut(s) 184
BsuRI GGCC 1 cut(s) 14
BtgI CCRYGG 1 cut(s) 196
BtsCI GGATG 1 cut(s) 65
Csp6I GTAC 3 cut(s) 18, 167, 173
CviAII CATG 2 cut(s) 128, 197
CviJI RGCY 2 cut(s) 14, 195
CviKI_1 RGCY 2 cut(s) 14, 195
CviQI GTAC 3 cut(s) 18, 167, 173
DpnI GATC 1 cut(s) 44
DpnII GATC 1 cut(s) 42
DraI TTTAAA 1 cut(s) 148
DraIII CACNNNGTG 1 cut(s) 130
Eco130I CCWWGG 1 cut(s) 196
Eco147I AGGCCT 1 cut(s) 14
EcoRII CCWGG 1 cut(s) 184
EcoT14I CCWWGG 1 cut(s) 196
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 2 cut(s) 131, 200
FaiI YATR 4 cut(s) 9, 129, 137, 198
FatI CATG 2 cut(s) 127, 196
FokI GGATG 1 cut(s) 52
GsuI CTGGAG 1 cut(s) 207
HaeIII GGCC 1 cut(s) 14
Hin1II CATG 2 cut(s) 131, 200
HinfI GANTC 2 cut(s) 34, 121
HphI GGTGA 2 cut(s) 43, 116
Hpy99I CGWCG 1 cut(s) 77
HpyAV CCTTC 2 cut(s) 147, 186
HpyCH4IV ACGT 3 cut(s) 27, 72, 204
HpySE526I ACGT 3 cut(s) 27, 72, 204
Hsp92II CATG 2 cut(s) 131, 200
Kzo9I GATC 1 cut(s) 42
LpnPI CCDG 5 cut(s) 28, 69, 171, 183, 198
MaeII ACGT 3 cut(s) 27, 72, 204
MaeIII GTNAC 1 cut(s) 200
MalI GATC 1 cut(s) 44
MboI GATC 1 cut(s) 42
MboII GAAGA 2 cut(s) 49, 52
MluCI AATT 1 cut(s) 87
MmeI TCCRAC 1 cut(s) 93
MseI TTAA 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 186
MvaI CCWGG 1 cut(s) 186
NcoI CCATGG 1 cut(s) 196
NdeII GATC 1 cut(s) 42
NlaIII CATG 2 cut(s) 131, 200
PceI AGGCCT 1 cut(s) 14
PfeI GAWTC 2 cut(s) 34, 121
Ppu21I YACGTR 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 184
PspGI CCWGG 1 cut(s) 184
RsaI GTAC 3 cut(s) 19, 168, 174
RsaNI GTAC 3 cut(s) 18, 167, 173
SaqAI TTAA 1 cut(s) 147
Sau3AI GATC 1 cut(s) 42
ScrFI CCNGG 1 cut(s) 186
SetI ASST 6 cut(s) 30, 75, 178, 187, 207, 211
SgeI CNNG 9 cut(s) 27, 40, 52, 96, 140, 182, 197, 198, 209
Sse9I AATT 1 cut(s) 87
SseBI AGGCCT 1 cut(s) 14
StuI AGGCCT 1 cut(s) 14
StyD4I CCNGG 1 cut(s) 184
StyI CCWWGG 1 cut(s) 196
TaiI ACGT 3 cut(s) 30, 75, 207
TasI AATT 1 cut(s) 87
TatI WGTACW 1 cut(s) 17
TfiI GAWTC 2 cut(s) 34, 121
Tru1I TTAA 1 cut(s) 147
Tru9I TTAA 1 cut(s) 147
XapI RAATTY 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.