Rorug05G0297500

ATP10 protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
34310817 .. 34315243
4427 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0297500.1

Sequence Viewer

Length: 420 bp
ATGTTCAAGATAACTCCTAACAAAGTCTGTATAAAAGCAGGAGTAGTTGATGCGCTTAATGCAATGCAGAAACATGTACAAGAAAAGGTCAAGAAGAGACTAGACAAAGAGAAACCCTTTTCTGTTCTCAATGTTTCATTTGATGTGTTCAGAAAATTAGTTCGTTTGGATGACGAAACTGAGTGCCTCATCACTGGATGGGATGAAACATTGGAACGCTTTGATCTGTGGCACGCTCATCCATTTCCTCCCACTGAATTGAAATCAGTGGAGAATTACCAAACATGCGGGACTGGGAGGTTTTATGCTCTTAAGATGTTAAAGCAATTCATACGCTACAATTTCATTCTACTAACTCAGTATTTTACTAGATATGAACCCAACATGTGTGTTGGAGAAGCTGAAGAGGTTGCTATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

16.34

Weight (kDa)

7.65

Isoelectric Point (pI)

29.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010232)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 288
AfaI GTAC 1 cut(s) 78
AflII CTTAAG 1 cut(s) 311
AflIII ACRYGT 2 cut(s) 73, 384
AgsI TTSAA 2 cut(s) 7, 262
AluBI AGCT 1 cut(s) 401
AluI AGCT 1 cut(s) 401
Alw26I GTCTC 1 cut(s) 91
AspLEI GCGC 1 cut(s) 55
BccI CCATC 1 cut(s) 192
BcoDI GTCTC 1 cut(s) 91
BfaI CTAG 2 cut(s) 101, 369
BfrI CTTAAG 1 cut(s) 311
BmrI ACTGGG 1 cut(s) 303
BmsI GCATC 1 cut(s) 40
BmuI ACTGGG 1 cut(s) 303
Bse1I ACTGG 2 cut(s) 199, 298
Bse3DI GCAATG 1 cut(s) 69
BseGI GGATG 4 cut(s) 175, 203, 208, 238
BseMI GCAATG 1 cut(s) 69
BseMII CTCAG 2 cut(s) 171, 371
BseNI ACTGG 2 cut(s) 199, 298
BslFI GGGAC 1 cut(s) 304
BsmAI GTCTC 1 cut(s) 91
BsmFI GGGAC 1 cut(s) 304
Bsp1407I TGTACA 1 cut(s) 76
Bsp143I GATC 1 cut(s) 223
BspACI CCGC 1 cut(s) 288
BspCNI CTCAG 2 cut(s) 172, 370
BspTI CTTAAG 1 cut(s) 311
BsrDI GCAATG 1 cut(s) 69
BsrGI TGTACA 1 cut(s) 76
BsrI ACTGG 2 cut(s) 199, 298
BssMI GATC 1 cut(s) 223
Bst6I CTCTTC 2 cut(s) 89, 399
BstAFI CTTAAG 1 cut(s) 311
BstAUI TGTACA 1 cut(s) 76
BstC8I GCNNGC 1 cut(s) 234
BstDEI CTNAG 2 cut(s) 180, 357
BstF5I GGATG 4 cut(s) 175, 203, 208, 238
BstHHI GCGC 1 cut(s) 55
BstKTI GATC 1 cut(s) 226
BstMAI GTCTC 1 cut(s) 91
BstMBI GATC 1 cut(s) 223
BstMWI GCNNNNNNNGC 1 cut(s) 59
BstNSI RCATGY 3 cut(s) 77, 288, 388
BtsCI GGATG 4 cut(s) 175, 203, 208, 238
BtsIMutI CAGTG 3 cut(s) 192, 252, 273
Cac8I GCNNGC 1 cut(s) 234
CfoI GCGC 1 cut(s) 55
Csp6I GTAC 1 cut(s) 77
CviAII CATG 3 cut(s) 74, 285, 385
CviJI RGCY 1 cut(s) 401
CviKI_1 RGCY 1 cut(s) 401
CviQI GTAC 1 cut(s) 77
DdeI CTNAG 2 cut(s) 180, 357
DpnI GATC 1 cut(s) 225
DpnII GATC 1 cut(s) 223
Eam1104I CTCTTC 2 cut(s) 89, 399
EarI CTCTTC 2 cut(s) 89, 399
FaeI CATG 3 cut(s) 77, 288, 388
FaiI YATR 9 cut(s) 32, 75, 286, 306, 332, 375, 386, 416, 418
FaqI GGGAC 1 cut(s) 304
FatI CATG 3 cut(s) 73, 284, 384
FauI CCCGC 1 cut(s) 281
FokI GGATG 4 cut(s) 182, 210, 215, 225
FspBI CTAG 2 cut(s) 101, 369
GlaI GCGC 1 cut(s) 54
HhaI GCGC 1 cut(s) 55
Hin1II CATG 3 cut(s) 77, 288, 388
Hin6I GCGC 1 cut(s) 53
HinP1I GCGC 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 152
Hpy188III TCNNGA 2 cut(s) 7, 91
HpyCH4V TGCA 2 cut(s) 62, 67
HpyF10VI GCNNNNNNNGC 1 cut(s) 59
HpyF3I CTNAG 2 cut(s) 180, 357
Hsp92II CATG 3 cut(s) 77, 288, 388
HspAI GCGC 1 cut(s) 53
Kzo9I GATC 1 cut(s) 223
LpnPI CCDG 3 cut(s) 24, 180, 279
LweI GCATC 1 cut(s) 40
MaeI CTAG 2 cut(s) 101, 369
MalI GATC 1 cut(s) 225
MboI GATC 1 cut(s) 223
MboII GAAGA 2 cut(s) 106, 416
MluCI AATT 5 cut(s) 155, 257, 274, 326, 340
MmeI TCCRAC 1 cut(s) 373
MnlI CCTC 4 cut(s) 197, 258, 291, 400
MseI TTAA 3 cut(s) 57, 312, 320
MspCI CTTAAG 1 cut(s) 311
MwoI GCNNNNNNNGC 1 cut(s) 59
NdeII GATC 1 cut(s) 223
NlaIII CATG 3 cut(s) 77, 288, 388
NspI RCATGY 3 cut(s) 77, 288, 388
PciI ACATGT 2 cut(s) 73, 384
PscI ACATGT 2 cut(s) 73, 384
RsaI GTAC 1 cut(s) 78
RsaNI GTAC 1 cut(s) 77
SaqAI TTAA 3 cut(s) 57, 312, 320
Sau3AI GATC 1 cut(s) 223
SetI ASST 4 cut(s) 90, 302, 403, 411
SfaNI GCATC 1 cut(s) 40
SmlI CTYRAG 1 cut(s) 311
SmoI CTYRAG 1 cut(s) 311
Sse9I AATT 5 cut(s) 155, 257, 274, 326, 340
SsiI CCGC 1 cut(s) 288
SspMI CTAG 2 cut(s) 101, 369
TasI AATT 5 cut(s) 155, 257, 274, 326, 340
TatI WGTACW 1 cut(s) 76
Tru1I TTAA 3 cut(s) 57, 312, 320
Tru9I TTAA 3 cut(s) 57, 312, 320
TscAI CASTG 3 cut(s) 199, 259, 273
TspDTI ATGAA 5 cut(s) 126, 219, 319, 334, 390
TspRI CASTG 3 cut(s) 199, 259, 273
Vha464I CTTAAG 1 cut(s) 311
XceI RCATGY 3 cut(s) 77, 288, 388
XspI CTAG 2 cut(s) 101, 369
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.