Rorug05G0412900

phosphatase 2c

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
57041154 .. 57041411
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0412900.1

Sequence Viewer

Length: 258 bp
ATGGCTCAAGGGAGAGGGAAGCAGATAAGGAAGGTTCAAAAAATGCCTCCACTTCAACAGCCAGCTACAACAACTACGACATATAATGTGTTAGCTACACCTACTGTGCTTGAAAATGTGCCAGCAACACCAACTATGATAGATAACGTGTTAGCTACCCCTACTATGCGTGAAAATGTGCCAGCAACAACTACTATTCATGCTAGCATGCGCCATGATGGTCCCAATGTTAGGTTGAATTATGTTCCATCACGATGA

Protein Analysis

85

Amino Acids

9.34

Weight (kDa)

10.51

Isoelectric Point (pI)

50.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 231
AflIII ACRYGT 1 cut(s) 147
AgsI TTSAA 4 cut(s) 38, 56, 113, 238
AluBI AGCT 3 cut(s) 65, 95, 155
AluI AGCT 3 cut(s) 65, 95, 155
AspLEI GCGC 1 cut(s) 213
AspS9I GGNCC 1 cut(s) 221
AsuNHI GCTAGC 1 cut(s) 203
AvaII GGWCC 1 cut(s) 221
BccI CCATC 2 cut(s) 212, 256
BfaI CTAG 1 cut(s) 204
Bme18I GGWCC 1 cut(s) 221
BmgT120I GGNCC 1 cut(s) 221
BmiI GGNNCC 1 cut(s) 223
BmtI GCTAGC 1 cut(s) 207
Bsc4I CCNNNNNNNGG 1 cut(s) 231
BseLI CCNNNNNNNGG 1 cut(s) 231
BslFI GGGAC 1 cut(s) 207
BslI CCNNNNNNNGG 1 cut(s) 231
BsmFI GGGAC 1 cut(s) 207
BspLI GGNNCC 1 cut(s) 223
BspOI GCTAGC 1 cut(s) 207
Bst4CI ACNGT 1 cut(s) 106
BstC8I GCNNGC 5 cut(s) 63, 123, 183, 205, 209
BstHHI GCGC 1 cut(s) 213
BstNSI RCATGY 1 cut(s) 211
Cac8I GCNNGC 5 cut(s) 63, 123, 183, 205, 209
CfoI GCGC 1 cut(s) 213
Cfr13I GGNCC 1 cut(s) 221
CviAII CATG 3 cut(s) 200, 208, 215
CviJI RGCY 5 cut(s) 5, 61, 65, 95, 155
CviKI_1 RGCY 5 cut(s) 5, 61, 65, 95, 155
Eco47I GGWCC 1 cut(s) 221
FaeI CATG 3 cut(s) 203, 211, 218
FaiI YATR 8 cut(s) 82, 84, 137, 167, 201, 209, 216, 243
FaqI GGGAC 1 cut(s) 207
FatI CATG 3 cut(s) 199, 207, 214
FspBI CTAG 1 cut(s) 204
GlaI GCGC 1 cut(s) 212
HhaI GCGC 1 cut(s) 213
Hin1II CATG 3 cut(s) 203, 211, 218
Hin6I GCGC 1 cut(s) 211
HinP1I GCGC 1 cut(s) 211
Hpy188III TCNNGA 1 cut(s) 252
HpyAV CCTTC 1 cut(s) 25
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4IV ACGT 1 cut(s) 147
HpySE526I ACGT 1 cut(s) 147
Hsp92II CATG 3 cut(s) 203, 211, 218
HspAI GCGC 1 cut(s) 211
LpnPI CCDG 3 cut(s) 75, 135, 195
MaeI CTAG 1 cut(s) 204
MaeII ACGT 1 cut(s) 147
MluCI AATT 1 cut(s) 238
MnlI CCTC 2 cut(s) 8, 57
MslI CAYNNNNRTG 1 cut(s) 253
NheI GCTAGC 1 cut(s) 203
NlaIII CATG 3 cut(s) 203, 211, 218
NlaIV GGNNCC 1 cut(s) 223
NspI RCATGY 1 cut(s) 211
PaeI GCATGC 1 cut(s) 211
PspN4I GGNNCC 1 cut(s) 223
PspPI GGNCC 1 cut(s) 221
RseI CAYNNNNRTG 1 cut(s) 253
Sau96I GGNCC 1 cut(s) 221
SetI ASST 7 cut(s) 36, 67, 97, 103, 150, 157, 236
SinI GGWCC 1 cut(s) 221
SmiMI CAYNNNNRTG 1 cut(s) 253
SmlI CTYRAG 1 cut(s) 6
SmoI CTYRAG 1 cut(s) 6
SphI GCATGC 1 cut(s) 211
Sse9I AATT 1 cut(s) 238
SspMI CTAG 1 cut(s) 204
TaaI ACNGT 1 cut(s) 106
TaiI ACGT 1 cut(s) 150
TasI AATT 1 cut(s) 238
TspDTI ATGAA 1 cut(s) 188
VpaK11BI GGWCC 1 cut(s) 221
XceI RCATGY 1 cut(s) 211
XspI CTAG 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.