Rorug06G0166900

Zein-binding

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
24375528 .. 24375683
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0166900.1

Sequence Viewer

Length: 156 bp
ATGCCGGGTTCTTATTTCACTCATGCTTATCGTCAAGCCAATGTTGTGGCTCATACTTTAGCTAGTTATGCTTGTTCTTCTTCTAGTTCTTTATTTTGGGGCCTAGAGCCTCCAGCTTGTATTGTTGATGTACTTTCTAAGGAGTTTACCTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.53

Weight (kDa)

5.97

Isoelectric Point (pI)

57.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 132
AluBI AGCT 2 cut(s) 62, 116
AluI AGCT 2 cut(s) 62, 116
AoxI GGCC 1 cut(s) 100
AspS9I GGNCC 1 cut(s) 100
AsuC2I CCSGG 1 cut(s) 6
BcnI CCSGG 1 cut(s) 6
BfaI CTAG 3 cut(s) 63, 84, 104
Bme1390I CCNGG 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 100
BmiI GGNNCC 1 cut(s) 101
BmrFI CCNGG 1 cut(s) 6
BplI GAGNNNNNCTC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 96
BpuMI CCSGG 1 cut(s) 6
BshFI GGCC 1 cut(s) 102
BsiSI CCGG 1 cut(s) 5
BsnI GGCC 1 cut(s) 102
BspANI GGCC 1 cut(s) 102
BspLI GGNNCC 1 cut(s) 101
BstDEI CTNAG 1 cut(s) 138
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstSCI CCNGG 1 cut(s) 4
BstXI CCANNNNNNTGG 1 cut(s) 46
BsuRI GGCC 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 100
Csp6I GTAC 1 cut(s) 131
CviAII CATG 1 cut(s) 23
CviJI RGCY 6 cut(s) 38, 50, 62, 102, 109, 116
CviKI_1 RGCY 6 cut(s) 38, 50, 62, 102, 109, 116
CviQI GTAC 1 cut(s) 131
DdeI CTNAG 1 cut(s) 138
EcoO109I RGGNCCY 1 cut(s) 100
FaeI CATG 1 cut(s) 26
FaiI YATR 3 cut(s) 24, 54, 69
FatI CATG 1 cut(s) 22
FspBI CTAG 3 cut(s) 63, 84, 104
GsuI CTGGAG 1 cut(s) 96
HaeIII GGCC 1 cut(s) 102
HapII CCGG 1 cut(s) 5
Hin1II CATG 1 cut(s) 26
HpaII CCGG 1 cut(s) 5
Hpy166II GTNNAC 1 cut(s) 147
Hpy8I GTNNAC 1 cut(s) 147
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
HpyF3I CTNAG 1 cut(s) 138
Hsp92II CATG 1 cut(s) 26
LpnPI CCDG 2 cut(s) 18, 126
MaeI CTAG 3 cut(s) 63, 84, 104
MboII GAAGA 2 cut(s) 69, 72
MnlI CCTC 1 cut(s) 120
MspI CCGG 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 6
MwoI GCNNNNNNNGC 1 cut(s) 68
NciI CCSGG 1 cut(s) 6
NlaIII CATG 1 cut(s) 26
NlaIV GGNNCC 1 cut(s) 101
PspN4I GGNNCC 1 cut(s) 101
PspPI GGNCC 1 cut(s) 100
RsaI GTAC 1 cut(s) 132
RsaNI GTAC 1 cut(s) 131
Sau96I GGNCC 1 cut(s) 100
ScrFI CCNGG 1 cut(s) 6
SetI ASST 3 cut(s) 64, 118, 152
SspMI CTAG 3 cut(s) 63, 84, 104
StyD4I CCNGG 1 cut(s) 4
TatI WGTACW 1 cut(s) 130
XspI CTAG 3 cut(s) 63, 84, 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.