Rorug06G0191100

DNA repair

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
30649579 .. 30650398
820 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0191100.1

Sequence Viewer

Length: 210 bp
ATGGTAAATGGACTGGTGGCATTGATGGAAGGCGAACATGTGGGGCCTTTCAACCTGGGAAATCCCGGGGAATTCACCATGCTAGAGCTTGCTGAGGTTGTGAAAGAAACAATTGATTCAAGTGCAACAATAGAATTCAGGCCAAATACTGCTAATGATCCTCATAAGAGGAAACCTGATATTGGCAAAGCAAAAGAGCTGTTGATCTAG

Protein Analysis

69

Amino Acids

7.53

Weight (kDa)

4.98

Isoelectric Point (pI)

22.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 152
AcsI RAATTY 2 cut(s) 71, 134
AfiI CCNNNNNNNGG 1 cut(s) 182
AflIII ACRYGT 1 cut(s) 37
AgsI TTSAA 2 cut(s) 52, 120
AjnI CCWGG 1 cut(s) 54
AluBI AGCT 2 cut(s) 88, 199
AluI AGCT 2 cut(s) 88, 199
AlwI GGATC 1 cut(s) 152
Ama87I CYCGRG 1 cut(s) 65
AoxI GGCC 2 cut(s) 44, 140
ApoI RAATTY 2 cut(s) 71, 134
AspS9I GGNCC 1 cut(s) 44
AsuC2I CCSGG 2 cut(s) 66, 67
AsuHPI GGTGA 1 cut(s) 67
AvaI CYCGRG 1 cut(s) 65
BbvCI CCTCAGC 1 cut(s) 93
BccI CCATC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 56
BcnI CCSGG 2 cut(s) 66, 67
BfaI CTAG 2 cut(s) 83, 208
Bme1390I CCNGG 3 cut(s) 56, 66, 67
BmeT110I CYCGRG 1 cut(s) 65
BmgT120I GGNCC 1 cut(s) 44
BmiI GGNNCC 1 cut(s) 45
BmrFI CCNGG 3 cut(s) 56, 66, 67
Bpu10I CCTNAGC 1 cut(s) 93
BpuMI CCSGG 2 cut(s) 66, 67
BsaJI CCNNGG 3 cut(s) 55, 65, 66
Bsc4I CCNNNNNNNGG 1 cut(s) 182
Bse1I ACTGG 1 cut(s) 18
BseBI CCWGG 1 cut(s) 56
BseDI CCNNGG 3 cut(s) 55, 65, 66
BseLI CCNNNNNNNGG 1 cut(s) 182
BseMII CTCAG 1 cut(s) 84
BseNI ACTGG 1 cut(s) 18
BshFI GGCC 2 cut(s) 46, 142
BsiHKCI CYCGRG 1 cut(s) 65
BsiSI CCGG 1 cut(s) 66
BslI CCNNNNNNNGG 1 cut(s) 182
BsnI GGCC 2 cut(s) 46, 142
BsoBI CYCGRG 1 cut(s) 65
Bsp143I GATC 2 cut(s) 157, 204
BspANI GGCC 2 cut(s) 46, 142
BspCNI CTCAG 1 cut(s) 85
BspLI GGNNCC 1 cut(s) 45
BspPI GGATC 1 cut(s) 152
BsrI ACTGG 1 cut(s) 18
BssECI CCNNGG 3 cut(s) 55, 65, 66
BssMI GATC 2 cut(s) 157, 204
Bst2UI CCWGG 1 cut(s) 56
BstC8I GCNNGC 1 cut(s) 90
BstDEI CTNAG 1 cut(s) 93
BstKTI GATC 2 cut(s) 160, 207
BstMBI GATC 2 cut(s) 157, 204
BstNI CCWGG 1 cut(s) 56
BstNSI RCATGY 1 cut(s) 41
BstSCI CCNGG 3 cut(s) 54, 64, 65
BsuRI GGCC 2 cut(s) 46, 142
Cac8I GCNNGC 1 cut(s) 90
Cfr13I GGNCC 1 cut(s) 44
Cfr9I CCCGGG 1 cut(s) 65
CviAII CATG 2 cut(s) 38, 79
CviJI RGCY 4 cut(s) 46, 88, 142, 199
CviKI_1 RGCY 4 cut(s) 46, 88, 142, 199
DdeI CTNAG 1 cut(s) 93
DpnI GATC 2 cut(s) 159, 206
DpnII GATC 2 cut(s) 157, 204
Eco88I CYCGRG 1 cut(s) 65
EcoO109I RGGNCCY 1 cut(s) 44
EcoRI GAATTC 2 cut(s) 71, 134
EcoRII CCWGG 1 cut(s) 54
FaeI CATG 2 cut(s) 41, 82
FaiI YATR 3 cut(s) 39, 80, 165
FatI CATG 2 cut(s) 37, 78
FspBI CTAG 2 cut(s) 83, 208
HaeIII GGCC 2 cut(s) 46, 142
HapII CCGG 1 cut(s) 66
Hin1II CATG 2 cut(s) 41, 82
HinfI GANTC 1 cut(s) 116
HpaII CCGG 1 cut(s) 66
HphI GGTGA 1 cut(s) 67
HpyAV CCTTC 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 125
HpyF3I CTNAG 1 cut(s) 93
Hsp92II CATG 2 cut(s) 41, 82
Kzo9I GATC 2 cut(s) 157, 204
LpnPI CCDG 5 cut(s) 41, 68, 79, 124, 189
MaeI CTAG 2 cut(s) 83, 208
MalI GATC 2 cut(s) 159, 206
MboI GATC 2 cut(s) 157, 204
MfeI CAATTG 1 cut(s) 111
MluCI AATT 3 cut(s) 71, 111, 134
MnlI CCTC 3 cut(s) 88, 162, 171
MspI CCGG 1 cut(s) 66
MspR9I CCNGG 3 cut(s) 56, 66, 67
MunI CAATTG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 56
NciI CCSGG 2 cut(s) 66, 67
NdeII GATC 2 cut(s) 157, 204
NlaIII CATG 2 cut(s) 41, 82
NlaIV GGNNCC 1 cut(s) 45
NspI RCATGY 1 cut(s) 41
PciI ACATGT 1 cut(s) 37
PfeI GAWTC 1 cut(s) 116
PscI ACATGT 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 54
PspGI CCWGG 1 cut(s) 54
PspN4I GGNNCC 1 cut(s) 45
PspPI GGNCC 1 cut(s) 44
Sau3AI GATC 2 cut(s) 157, 204
Sau96I GGNCC 1 cut(s) 44
ScrFI CCNGG 3 cut(s) 56, 66, 67
SetI ASST 5 cut(s) 57, 90, 99, 178, 201
SmaI CCCGGG 1 cut(s) 67
Sse9I AATT 3 cut(s) 71, 111, 134
SspMI CTAG 2 cut(s) 83, 208
StyD4I CCNGG 3 cut(s) 54, 64, 65
TasI AATT 3 cut(s) 71, 111, 134
TfiI GAWTC 1 cut(s) 116
TspMI CCCGGG 1 cut(s) 65
XapI RAATTY 2 cut(s) 71, 134
XceI RCATGY 1 cut(s) 41
XmaI CCCGGG 1 cut(s) 65
XspI CTAG 2 cut(s) 83, 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.