Rorug06G0220600

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Reverse (-)
35320665 .. 35320991
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0220600.1

Sequence Viewer

Length: 327 bp
ATGATTTTGATGATTTCATGCATGGATCTTCTTTTCTCATTACAGTTACATAATGTTGTAATCGAAAGTGACTGCTTAGAAGCACTTAATGAAGTTTCCAGCCCTCAATATGAGTTACTAGCCAATGGAGGTTTGATTGATGATATAAAACAAAGTTGGAGAATGCTGCAAGGTGTGAAAATTCAACACACTCCTAGATCATGTAATGCGGTGGCTCACCGCCTAGCTGCTTTAGGTTTTGAGGCAGAGCAAGGTTTTGTTTGGTTTGAACAAGCACCTGAAGATATTCGAGATGTGCTTCTACATGATTGTAATCAACTCAGTTGA

Protein Analysis

108

Amino Acids

12.18

Weight (kDa)

4.57

Isoelectric Point (pI)

56.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 8 - 77 1.5e-07 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011732)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 209, 220
AclWI GGATC 1 cut(s) 33
AcsI RAATTY 1 cut(s) 180
AcuI CTGAAG 1 cut(s) 300
AgsI TTSAA 2 cut(s) 185, 269
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
AlwI GGATC 1 cut(s) 33
ApeKI GCWGC 2 cut(s) 166, 227
ApoI RAATTY 1 cut(s) 180
Asp700I GAANNNNTTC 1 cut(s) 285
AsuHPI GGTGA 1 cut(s) 209
BbvI GCAGC 2 cut(s) 153, 214
BfaI CTAG 3 cut(s) 119, 195, 224
BisI GCNGC 2 cut(s) 167, 228
BlsI GCNGC 2 cut(s) 168, 229
BsaBI GATNNNNATC 1 cut(s) 312
Bse8I GATNNNNATC 1 cut(s) 312
BseJI GATNNNNATC 1 cut(s) 312
BseXI GCAGC 2 cut(s) 153, 214
BsmI GAATGC 1 cut(s) 168
Bsp143I GATC 2 cut(s) 25, 197
BspACI CCGC 2 cut(s) 209, 220
BspPI GGATC 1 cut(s) 33
BssMI GATC 2 cut(s) 25, 197
Bst4CI ACNGT 1 cut(s) 45
BstDEI CTNAG 2 cut(s) 76, 320
BstKTI GATC 2 cut(s) 28, 200
BstMBI GATC 2 cut(s) 25, 197
BstV1I GCAGC 2 cut(s) 153, 214
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
CviAII CATG 4 cut(s) 18, 22, 201, 305
CviJI RGCY 4 cut(s) 102, 122, 215, 227
CviKI_1 RGCY 4 cut(s) 102, 122, 215, 227
DdeI CTNAG 2 cut(s) 76, 320
DpnI GATC 2 cut(s) 27, 199
DpnII GATC 2 cut(s) 25, 197
Eco57I CTGAAG 1 cut(s) 300
EcoT22I ATGCAT 1 cut(s) 23
FaeI CATG 4 cut(s) 21, 25, 204, 308
FaiI YATR 7 cut(s) 19, 23, 51, 111, 146, 202, 306
FatI CATG 4 cut(s) 17, 21, 200, 304
Fnu4HI GCNGC 2 cut(s) 167, 228
Fsp4HI GCNGC 2 cut(s) 167, 228
FspBI CTAG 3 cut(s) 119, 195, 224
GluI GCNGC 2 cut(s) 167, 228
Hin1II CATG 4 cut(s) 21, 25, 204, 308
HphI GGTGA 1 cut(s) 209
Hpy188III TCNNGA 1 cut(s) 290
HpyCH4III ACNGT 1 cut(s) 45
HpyCH4V TGCA 2 cut(s) 21, 169
HpyF3I CTNAG 2 cut(s) 76, 320
Hsp92II CATG 4 cut(s) 21, 25, 204, 308
Kzo9I GATC 2 cut(s) 25, 197
LpnPI CCDG 2 cut(s) 112, 291
Lsp1109I GCAGC 2 cut(s) 153, 214
MaeI CTAG 3 cut(s) 119, 195, 224
MaeIII GTNAC 3 cut(s) 45, 68, 114
MalI GATC 2 cut(s) 27, 199
MboI GATC 2 cut(s) 25, 197
MboII GAAGA 2 cut(s) 20, 293
MflI RGATCY 1 cut(s) 25
MluCI AATT 1 cut(s) 180
MmeI TCCRAC 1 cut(s) 137
MnlI CCTC 3 cut(s) 114, 122, 235
Mph1103I ATGCAT 1 cut(s) 23
MroXI GAANNNNTTC 1 cut(s) 285
MseI TTAA 1 cut(s) 87
Mva1269I GAATGC 1 cut(s) 168
NdeII GATC 2 cut(s) 25, 197
NlaIII CATG 4 cut(s) 21, 25, 204, 308
NmuCI GTSAC 1 cut(s) 68
NsiI ATGCAT 1 cut(s) 23
PctI GAATGC 1 cut(s) 168
PdmI GAANNNNTTC 1 cut(s) 285
PkrI GCNGC 2 cut(s) 168, 229
PsuI RGATCY 1 cut(s) 25
SaqAI TTAA 1 cut(s) 87
SatI GCNGC 2 cut(s) 167, 228
Sau3AI GATC 2 cut(s) 25, 197
SetI ASST 6 cut(s) 133, 175, 229, 238, 256, 280
Sse9I AATT 1 cut(s) 180
SsiI CCGC 2 cut(s) 209, 220
SspMI CTAG 3 cut(s) 119, 195, 224
TaaI ACNGT 1 cut(s) 45
TaqI TCGA 2 cut(s) 63, 289
TasI AATT 1 cut(s) 180
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TseFI GTSAC 1 cut(s) 68
TseI GCWGC 2 cut(s) 166, 227
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 2 cut(s) 6, 105
XapI RAATTY 1 cut(s) 180
XmnI GAANNNNTTC 1 cut(s) 285
XspI CTAG 3 cut(s) 119, 195, 224
Zsp2I ATGCAT 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.