Rorug07G0161800

psbP domain-containing protein 3

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Reverse (-)
12968142 .. 12968300
159 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0161800.1

Sequence Viewer

Length: 159 bp
ATGTTGGTGAAGAGGTCGTATCGTGACACTCGGGATTGGTTATCTTTCTTCGTAGCCTGGGGTGATAGGCGTAAAAATTGGTTAGGGGTTGGACCTTTTCGGTTCATGGATGTTACTATTAGTGACCTGTTTAAGGATAATAGATTCGAGAGAGATTGA

Protein Analysis

52

Amino Acids

6.45

Weight (kDa)

9.97

Isoelectric Point (pI)

25.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 133
AjnI CCWGG 1 cut(s) 56
Ama87I CYCGRG 1 cut(s) 30
AspS9I GGNCC 1 cut(s) 92
AsuHPI GGTGA 2 cut(s) 19, 74
AvaI CYCGRG 1 cut(s) 30
AvaII GGWCC 1 cut(s) 92
BciT130I CCWGG 1 cut(s) 58
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 1 cut(s) 92
BmeT110I CYCGRG 1 cut(s) 30
BmgT120I GGNCC 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 58
BsaJI CCNNGG 1 cut(s) 57
Bsc4I CCNNNNNNNGG 1 cut(s) 133
BseBI CCWGG 1 cut(s) 58
BseDI CCNNGG 1 cut(s) 57
BseGI GGATG 1 cut(s) 115
BseLI CCNNNNNNNGG 1 cut(s) 133
BsiHKCI CYCGRG 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 133
BsoBI CYCGRG 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 57
Bst2UI CCWGG 1 cut(s) 58
Bst6I CTCTTC 1 cut(s) 5
BstENI CCTNNNNNAGG 1 cut(s) 131
BstF5I GGATG 1 cut(s) 115
BstNI CCWGG 1 cut(s) 58
BstSCI CCNGG 1 cut(s) 56
BtsCI GGATG 1 cut(s) 115
Cfr13I GGNCC 1 cut(s) 92
CviAII CATG 1 cut(s) 106
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
Eam1104I CTCTTC 1 cut(s) 5
EarI CTCTTC 1 cut(s) 5
Eco47I GGWCC 1 cut(s) 92
Eco88I CYCGRG 1 cut(s) 30
EcoNI CCTNNNNNAGG 1 cut(s) 131
EcoRII CCWGG 1 cut(s) 56
FaeI CATG 1 cut(s) 109
FaiI YATR 1 cut(s) 107
FatI CATG 1 cut(s) 105
FokI GGATG 1 cut(s) 122
Hin1II CATG 1 cut(s) 109
HinfI GANTC 1 cut(s) 144
HphI GGTGA 2 cut(s) 19, 74
Hpy188III TCNNGA 3 cut(s) 23, 32, 148
Hsp92II CATG 1 cut(s) 109
LpnPI CCDG 3 cut(s) 43, 70, 140
MaeIII GTNAC 3 cut(s) 23, 112, 122
MboII GAAGA 2 cut(s) 22, 40
MluCI AATT 1 cut(s) 76
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 1 cut(s) 6
MseI TTAA 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 58
MvaI CCWGG 1 cut(s) 58
NlaIII CATG 1 cut(s) 109
NmuCI GTSAC 2 cut(s) 23, 122
PfeI GAWTC 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 56
PspGI CCWGG 1 cut(s) 56
PspPI GGNCC 1 cut(s) 92
SaqAI TTAA 1 cut(s) 132
Sau96I GGNCC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 58
SetI ASST 3 cut(s) 17, 97, 129
SgeI CNNG 7 cut(s) 35, 42, 44, 69, 70, 118, 139
SinI GGWCC 1 cut(s) 92
Sse9I AATT 1 cut(s) 76
StyD4I CCNGG 1 cut(s) 56
TaqI TCGA 1 cut(s) 147
TasI AATT 1 cut(s) 76
TfiI GAWTC 1 cut(s) 144
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TseFI GTSAC 2 cut(s) 23, 122
Tsp45I GTSAC 2 cut(s) 23, 122
TspDTI ATGAA 1 cut(s) 94
VpaK11BI GGWCC 1 cut(s) 92
XagI CCTNNNNNAGG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.