Rh1AG369800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0015550
Physical Location & Seq
Reverse (-)
60358333 .. 60358977
645 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG369800.1

Sequence Viewer

Length: 645 bp
ATGTCTCTTCAGCAAAAGGGAAAAGTAAAGGCAAGCATGTCTCTTGAAATCTTTGAAAGAGATGAGCCAGAATTCGATCCCCATCTCCATCAACGGGACCTTGATAAACAGAGCCTAGAGCTTAAGAACCTTAAAGAATTGGAAGAGATACATCAGAAGCTTGAGAAACAGAAGCAAGAGCTTGAGAAGAAGGTCCGCGCACAAAACCAAAAGGCTCAACAATATGCTGCAGCTGCAGAGACCAAGAAGGCTATACAAGTCATTCCTAAACTACTGGACCTATATGCCGTGCATAAATCTAAGAAGAAAAAGGAGCGATTACAAAGAAAAATCAACAAGCTTGAAATCGATGAATTCGCCATTGATATTCAGATTACACTACTTGAAGGACGTGCTAAAGTTGAGGAAAAGCCTGTTTATGATGATGAATCACCCATAAAGGAAAAATCTGCAGTGAACAAGTCCCTAGAAAAAAACATGGCTATGAACAATGATGAATTGAGGGAAACAATACATGAGATCAATAAGGATATTAAGTACATGCAACTTAAATCCTTGGCAAAATTAGGGAGCTATTGTCAGTACAAGTTGAAGAAGCCGTTCATCTCGATGAAGAATAATCTATGCAAAGCGGTTAAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

214

Amino Acids

25.09

Weight (kDa)

9.37

Isoelectric Point (pI)

40.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 198
AciI CCGC 2 cut(s) 196, 632
AclWI GGATC 1 cut(s) 71
AcsI RAATTY 2 cut(s) 71, 353
AfaI GTAC 2 cut(s) 539, 584
AfiI CCNNNNNNNGG 1 cut(s) 94
AflII CTTAAG 1 cut(s) 122
AgsI TTSAA 5 cut(s) 47, 56, 344, 386, 592
AjiI CACGTC 1 cut(s) 392
AluBI AGCT 6 cut(s) 121, 160, 181, 233, 340, 573
AluI AGCT 6 cut(s) 121, 160, 181, 233, 340, 573
Alw26I GTCTC 3 cut(s) 9, 45, 233
AlwI GGATC 1 cut(s) 71
ApeKI GCWGC 3 cut(s) 227, 230, 233
ApoI RAATTY 2 cut(s) 71, 353
Asp700I GAANNNNTTC 1 cut(s) 599
AspLEI GCGC 1 cut(s) 200
AspS9I GGNCC 3 cut(s) 97, 193, 277
AsuHPI GGTGA 1 cut(s) 423
AvaII GGWCC 3 cut(s) 97, 193, 277
BbvI GCAGC 3 cut(s) 214, 220, 242
BccI CCATC 2 cut(s) 90, 96
BceAI ACGGC 2 cut(s) 272, 583
BcoDI GTCTC 3 cut(s) 9, 45, 233
BfaI CTAG 2 cut(s) 116, 467
BfmI CTRYAG 3 cut(s) 228, 234, 450
BfrI CTTAAG 1 cut(s) 122
BisI GCNGC 3 cut(s) 228, 231, 234
BlsI GCNGC 3 cut(s) 229, 232, 235
Bme18I GGWCC 3 cut(s) 97, 193, 277
BmgBI CACGTC 1 cut(s) 392
BmgT120I GGNCC 3 cut(s) 97, 193, 277
BmiI GGNNCC 1 cut(s) 98
BpuEI CTTGAG 2 cut(s) 182, 203
Bsa29I ATCGAT 1 cut(s) 348
BsaBI GATNNNNATC 1 cut(s) 81
BsaI GGTCTC 1 cut(s) 233
BsaJI CCNNGG 1 cut(s) 555
BsaXI ACNNNNNCTCC 2 cut(s) 562, 592
Bsc4I CCNNNNNNNGG 1 cut(s) 94
Bse1I ACTGG 1 cut(s) 279
Bse8I GATNNNNATC 1 cut(s) 81
BseCI ATCGAT 1 cut(s) 348
BseDI CCNNGG 1 cut(s) 555
BseJI GATNNNNATC 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 94
BseNI ACTGG 1 cut(s) 279
BseXI GCAGC 3 cut(s) 214, 220, 242
Bsh1236I CGCG 1 cut(s) 198
BshVI ATCGAT 1 cut(s) 348
BslFI GGGAC 2 cut(s) 110, 448
BslI CCNNNNNNNGG 1 cut(s) 94
BsmAI GTCTC 3 cut(s) 9, 45, 233
BsmFI GGGAC 2 cut(s) 110, 448
Bso31I GGTCTC 1 cut(s) 233
Bsp143I GATC 2 cut(s) 76, 519
BspACI CCGC 2 cut(s) 196, 632
BspDI ATCGAT 1 cut(s) 348
BspFNI CGCG 1 cut(s) 198
BspLI GGNNCC 1 cut(s) 98
BspMAI CTGCAG 3 cut(s) 232, 238, 454
BspPI GGATC 1 cut(s) 71
BspTI CTTAAG 1 cut(s) 122
BspTNI GGTCTC 1 cut(s) 233
BsrI ACTGG 1 cut(s) 279
BssECI CCNNGG 1 cut(s) 555
BssMI GATC 2 cut(s) 76, 519
BssT1I CCWWGG 1 cut(s) 555
Bst6I CTCTTC 2 cut(s) 12, 138
BstAFI CTTAAG 1 cut(s) 122
BstC8I GCNNGC 1 cut(s) 34
BstDEI CTNAG 1 cut(s) 300
BstFNI CGCG 1 cut(s) 198
BstHHI GCGC 1 cut(s) 200
BstKTI GATC 2 cut(s) 79, 522
BstMAI GTCTC 3 cut(s) 9, 45, 233
BstMBI GATC 2 cut(s) 76, 519
BstMWI GCNNNNNNNGC 1 cut(s) 233
BstNSI RCATGY 2 cut(s) 40, 544
BstSFI CTRYAG 3 cut(s) 228, 234, 450
BstUI CGCG 1 cut(s) 198
BstV1I GCAGC 3 cut(s) 214, 220, 242
Bsu15I ATCGAT 1 cut(s) 348
BsuTUI ATCGAT 1 cut(s) 348
BtrI CACGTC 1 cut(s) 392
BtsI GCAGTG 1 cut(s) 459
BtsIMutI CAGTG 1 cut(s) 459
Cac8I GCNNGC 1 cut(s) 34
CfoI GCGC 1 cut(s) 200
Cfr13I GGNCC 3 cut(s) 97, 193, 277
ClaI ATCGAT 1 cut(s) 348
Csp6I GTAC 2 cut(s) 538, 583
CviAII CATG 4 cut(s) 37, 478, 515, 541
CviQI GTAC 2 cut(s) 538, 583
DdeI CTNAG 1 cut(s) 300
DpnI GATC 2 cut(s) 78, 521
DpnII GATC 2 cut(s) 76, 519
Eam1104I CTCTTC 2 cut(s) 12, 138
EarI CTCTTC 2 cut(s) 12, 138
Eco130I CCWWGG 1 cut(s) 555
Eco31I GGTCTC 1 cut(s) 233
Eco47I GGWCC 3 cut(s) 97, 193, 277
EcoO109I RGGNCCY 1 cut(s) 97
EcoRI GAATTC 2 cut(s) 71, 353
EcoT14I CCWWGG 1 cut(s) 555
ErhI CCWWGG 1 cut(s) 555
FaeI CATG 4 cut(s) 40, 481, 518, 544
FaqI GGGAC 2 cut(s) 110, 448
FatI CATG 4 cut(s) 36, 477, 514, 540
Fnu4HI GCNGC 3 cut(s) 228, 231, 234
Fsp4HI GCNGC 3 cut(s) 228, 231, 234
FspBI CTAG 2 cut(s) 116, 467
GlaI GCGC 1 cut(s) 199
GluI GCNGC 3 cut(s) 228, 231, 234
HhaI GCGC 1 cut(s) 200
Hin1II CATG 4 cut(s) 40, 481, 518, 544
Hin6I GCGC 1 cut(s) 198
HinP1I GCGC 1 cut(s) 198
HindIII AAGCTT 2 cut(s) 158, 338
HinfI GANTC 1 cut(s) 428
HphI GGTGA 1 cut(s) 423
Hpy166II GTNNAC 1 cut(s) 457
Hpy188I TCNGA 2 cut(s) 156, 372
Hpy188III TCNNGA 2 cut(s) 44, 607
Hpy8I GTNNAC 1 cut(s) 457
HpyAV CCTTC 3 cut(s) 184, 241, 380
HpyCH4IV ACGT 1 cut(s) 391
HpyCH4V TGCA 6 cut(s) 230, 236, 292, 452, 544, 627
HpyF10VI GCNNNNNNNGC 1 cut(s) 233
HpyF3I CTNAG 1 cut(s) 300
HpySE526I ACGT 1 cut(s) 391
Hsp92II CATG 4 cut(s) 40, 481, 518, 544
HspAI GCGC 1 cut(s) 198
Kzo9I GATC 2 cut(s) 76, 519
LmnI GCTCC 2 cut(s) 313, 570
LpnPI CCDG 3 cut(s) 81, 260, 426
Lsp1109I GCAGC 3 cut(s) 214, 220, 242
MaeI CTAG 2 cut(s) 116, 467
MaeII ACGT 1 cut(s) 391
MalI GATC 2 cut(s) 78, 521
MboI GATC 2 cut(s) 76, 519
MboII GAAGA 5 cut(s) 155, 199, 316, 604, 625
MluCI AATT 5 cut(s) 71, 137, 353, 497, 563
MnlI CCTC 2 cut(s) 397, 495
MroXI GAANNNNTTC 1 cut(s) 599
MseI TTAA 5 cut(s) 123, 132, 534, 549, 636
MslI CAYNNNNRTG 2 cut(s) 482, 608
MspA1I CMGCKG 1 cut(s) 233
MspCI CTTAAG 1 cut(s) 122
MvnI CGCG 1 cut(s) 198
MwoI GCNNNNNNNGC 1 cut(s) 233
NdeII GATC 2 cut(s) 76, 519
NlaIII CATG 4 cut(s) 40, 481, 518, 544
NlaIV GGNNCC 1 cut(s) 98
NspI RCATGY 2 cut(s) 40, 544
PdmI GAANNNNTTC 1 cut(s) 599
PfeI GAWTC 1 cut(s) 428
PkrI GCNGC 3 cut(s) 229, 232, 235
PpuMI RGGWCCY 1 cut(s) 97
Psp5II RGGWCCY 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 98
PspPI GGNCC 3 cut(s) 97, 193, 277
PspPPI RGGWCCY 1 cut(s) 97
PstI CTGCAG 3 cut(s) 232, 238, 454
PvuII CAGCTG 1 cut(s) 233
RsaI GTAC 2 cut(s) 539, 584
RsaNI GTAC 2 cut(s) 538, 583
RseI CAYNNNNRTG 2 cut(s) 482, 608
SaqAI TTAA 5 cut(s) 123, 132, 534, 549, 636
SatI GCNGC 3 cut(s) 228, 231, 234
Sau3AI GATC 2 cut(s) 76, 519
Sau96I GGNCC 3 cut(s) 97, 193, 277
SfcI CTRYAG 3 cut(s) 228, 234, 450
SinI GGWCC 3 cut(s) 97, 193, 277
SmiMI CAYNNNNRTG 2 cut(s) 482, 608
SmlI CTYRAG 3 cut(s) 122, 161, 182
SmoI CTYRAG 3 cut(s) 122, 161, 182
Sse9I AATT 5 cut(s) 71, 137, 353, 497, 563
SsiI CCGC 2 cut(s) 196, 632
SspMI CTAG 2 cut(s) 116, 467
StyI CCWWGG 1 cut(s) 555
TaiI ACGT 1 cut(s) 394
TaqI TCGA 3 cut(s) 75, 348, 608
TasI AATT 5 cut(s) 71, 137, 353, 497, 563
TatI WGTACW 2 cut(s) 537, 582
TfiI GAWTC 1 cut(s) 428
Tru1I TTAA 5 cut(s) 123, 132, 534, 549, 636
Tru9I TTAA 5 cut(s) 123, 132, 534, 549, 636
TscAI CASTG 1 cut(s) 459
TseI GCWGC 3 cut(s) 227, 230, 233
TspDTI ATGAA 6 cut(s) 366, 441, 500, 510, 592, 626
TspRI CASTG 1 cut(s) 459
Vha464I CTTAAG 1 cut(s) 122
VpaK11BI GGWCC 3 cut(s) 97, 193, 277
XapI RAATTY 2 cut(s) 71, 353
XceI RCATGY 2 cut(s) 40, 544
XmnI GAANNNNTTC 1 cut(s) 599
XspI CTAG 2 cut(s) 116, 467
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.