Rh1CG104300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0015731
Physical Location & Seq
Reverse (-)
21469115 .. 21489376
20262 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG104300.1

Sequence Viewer

Length: 300 bp
ATGTCGCCAAAGGCCAAACGCACAGGGCAGCTTCCGCAGGAGGTGCTAGAAGGAATGGATATCCGTGCAGCAGTCAAACGCATCAAACGCATCAAAGGCATCGATGGCGTAATTCTTGATGAGTCTCAGAAAGAAGAGCTACATGGCCTTTACCAAGCCTTGTCAAAGAATGTTGAGGAAACCGGTGGGACACTTGCATTGGATGGGTCAACTGGAAACCTTTTTCCTGGTGCTGTTGTTCCAACAGGAGATCTGAGAAAGGGGTCCCAGGTCAACCCAACACAAACAACCTACTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

10.68

Weight (kDa)

7.99

Isoelectric Point (pI)

43.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 35
AgeI ACCGGT 1 cut(s) 182
AjnI CCWGG 2 cut(s) 226, 267
AluBI AGCT 2 cut(s) 31, 139
AluI AGCT 2 cut(s) 31, 139
Alw26I GTCTC 1 cut(s) 129
AoxI GGCC 2 cut(s) 12, 145
ApeKI GCWGC 2 cut(s) 28, 68
AsiGI ACCGGT 1 cut(s) 182
AspS9I GGNCC 1 cut(s) 264
AvaII GGWCC 1 cut(s) 264
BbvI GCAGC 2 cut(s) 40, 80
BccI CCATC 2 cut(s) 98, 197
BciT130I CCWGG 2 cut(s) 228, 269
BcoDI GTCTC 1 cut(s) 129
BfaI CTAG 1 cut(s) 47
BglII AGATCT 1 cut(s) 250
BisI GCNGC 2 cut(s) 29, 69
BlsI GCNGC 2 cut(s) 30, 70
Bme1390I CCNGG 2 cut(s) 228, 269
Bme18I GGWCC 1 cut(s) 264
BmgT120I GGNCC 1 cut(s) 264
BmiI GGNNCC 2 cut(s) 265, 266
BmrFI CCNGG 2 cut(s) 228, 269
BmsI GCATC 3 cut(s) 90, 99, 108
Bsa29I ATCGAT 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 267
BsaWI WCCGGW 1 cut(s) 182
Bse118I RCCGGY 1 cut(s) 182
Bse1I ACTGG 1 cut(s) 217
BseBI CCWGG 2 cut(s) 228, 269
BseCI ATCGAT 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 267
BseGI GGATG 1 cut(s) 208
BseMII CTCAG 2 cut(s) 140, 245
BseNI ACTGG 1 cut(s) 217
BseXI GCAGC 2 cut(s) 40, 80
BsgI GTGCAG 1 cut(s) 87
BshFI GGCC 2 cut(s) 14, 147
BshTI ACCGGT 1 cut(s) 182
BshVI ATCGAT 1 cut(s) 102
BsiSI CCGG 1 cut(s) 183
BslFI GGGAC 2 cut(s) 202, 250
BsmAI GTCTC 1 cut(s) 129
BsmFI GGGAC 2 cut(s) 202, 250
BsnI GGCC 2 cut(s) 14, 147
Bsp143I GATC 1 cut(s) 250
BspACI CCGC 1 cut(s) 35
BspANI GGCC 2 cut(s) 14, 147
BspCNI CTCAG 2 cut(s) 139, 246
BspDI ATCGAT 1 cut(s) 102
BspLI GGNNCC 2 cut(s) 265, 266
BspQI GCTCTTC 1 cut(s) 129
BsrFI RCCGGY 1 cut(s) 182
BsrI ACTGG 1 cut(s) 217
BssAI RCCGGY 1 cut(s) 182
BssECI CCNNGG 1 cut(s) 267
BssMI GATC 1 cut(s) 250
Bst2UI CCWGG 2 cut(s) 228, 269
Bst6I CTCTTC 1 cut(s) 129
BstAPI GCANNNNNTGC 1 cut(s) 43
BstDEI CTNAG 2 cut(s) 126, 254
BstF5I GGATG 1 cut(s) 208
BstKTI GATC 1 cut(s) 253
BstMAI GTCTC 1 cut(s) 129
BstMBI GATC 1 cut(s) 250
BstMWI GCNNNNNNNGC 5 cut(s) 34, 43, 87, 96, 105
BstNI CCWGG 2 cut(s) 228, 269
BstSCI CCNGG 2 cut(s) 226, 267
BstV1I GCAGC 2 cut(s) 40, 80
BstX2I RGATCY 1 cut(s) 250
BstYI RGATCY 1 cut(s) 250
Bsu15I ATCGAT 1 cut(s) 102
BsuRI GGCC 2 cut(s) 14, 147
BsuTUI ATCGAT 1 cut(s) 102
BtsCI GGATG 1 cut(s) 208
Cfr10I RCCGGY 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 264
ClaI ATCGAT 1 cut(s) 102
CspAI ACCGGT 1 cut(s) 182
CviAII CATG 1 cut(s) 143
CviJI RGCY 5 cut(s) 14, 31, 139, 147, 158
CviKI_1 RGCY 5 cut(s) 14, 31, 139, 147, 158
DdeI CTNAG 2 cut(s) 126, 254
DpnI GATC 1 cut(s) 252
DpnII GATC 1 cut(s) 250
Eam1104I CTCTTC 1 cut(s) 129
EarI CTCTTC 1 cut(s) 129
Eco32I GATATC 1 cut(s) 61
Eco47I GGWCC 1 cut(s) 264
EcoO109I RGGNCCY 1 cut(s) 264
EcoRII CCWGG 2 cut(s) 226, 267
EcoRV GATATC 1 cut(s) 61
FaeI CATG 1 cut(s) 146
FaiI YATR 1 cut(s) 144
FaqI GGGAC 2 cut(s) 202, 250
FatI CATG 1 cut(s) 142
Fnu4HI GCNGC 2 cut(s) 29, 69
FokI GGATG 1 cut(s) 215
Fsp4HI GCNGC 2 cut(s) 29, 69
FspBI CTAG 1 cut(s) 47
GluI GCNGC 2 cut(s) 29, 69
HaeIII GGCC 2 cut(s) 14, 147
HapII CCGG 1 cut(s) 183
Hin1II CATG 1 cut(s) 146
HincII GTYRAC 2 cut(s) 210, 274
HindII GTYRAC 2 cut(s) 210, 274
HinfI GANTC 1 cut(s) 122
HpaII CCGG 1 cut(s) 183
Hpy166II GTNNAC 2 cut(s) 210, 274
Hpy188I TCNGA 2 cut(s) 129, 255
Hpy188III TCNNGA 1 cut(s) 116
Hpy8I GTNNAC 2 cut(s) 210, 274
HpyAV CCTTC 1 cut(s) 44
HpyCH4V TGCA 2 cut(s) 68, 197
HpyF10VI GCNNNNNNNGC 5 cut(s) 34, 43, 87, 96, 105
HpyF3I CTNAG 2 cut(s) 126, 254
Hsp92II CATG 1 cut(s) 146
KflI GGGWCCC 1 cut(s) 264
Kzo9I GATC 1 cut(s) 250
LguI GCTCTTC 1 cut(s) 129
LpnPI CCDG 9 cut(s) 9, 23, 196, 198, 213, 231, 240, 254, 281
Lsp1109I GCAGC 2 cut(s) 40, 80
LweI GCATC 3 cut(s) 90, 99, 108
MaeI CTAG 1 cut(s) 47
MalI GATC 1 cut(s) 252
MboI GATC 1 cut(s) 250
MboII GAAGA 1 cut(s) 146
MflI RGATCY 1 cut(s) 250
MluCI AATT 1 cut(s) 111
MlyI GAGTC 1 cut(s) 131
MmeI TCCRAC 1 cut(s) 266
MnlI CCTC 2 cut(s) 34, 169
MspI CCGG 1 cut(s) 183
MspR9I CCNGG 2 cut(s) 228, 269
MvaI CCWGG 2 cut(s) 228, 269
MwoI GCNNNNNNNGC 5 cut(s) 34, 43, 87, 96, 105
NdeII GATC 1 cut(s) 250
NlaIII CATG 1 cut(s) 146
NlaIV GGNNCC 2 cut(s) 265, 266
PciSI GCTCTTC 1 cut(s) 129
PinAI ACCGGT 1 cut(s) 182
PkrI GCNGC 2 cut(s) 30, 70
PleI GAGTC 1 cut(s) 130
PpsI GAGTC 1 cut(s) 130
PpuMI RGGWCCY 1 cut(s) 264
Psp5II RGGWCCY 1 cut(s) 264
Psp6I CCWGG 2 cut(s) 226, 267
PspGI CCWGG 2 cut(s) 226, 267
PspN4I GGNNCC 2 cut(s) 265, 266
PspPI GGNCC 1 cut(s) 264
PspPPI RGGWCCY 1 cut(s) 264
PsuI RGATCY 1 cut(s) 250
SapI GCTCTTC 1 cut(s) 129
SatI GCNGC 2 cut(s) 29, 69
Sau3AI GATC 1 cut(s) 250
Sau96I GGNCC 1 cut(s) 264
SchI GAGTC 1 cut(s) 131
ScrFI CCNGG 2 cut(s) 228, 269
SetI ASST 6 cut(s) 33, 45, 141, 222, 273, 293
SfaNI GCATC 3 cut(s) 90, 99, 108
SinI GGWCC 1 cut(s) 264
Sse9I AATT 1 cut(s) 111
SsiI CCGC 1 cut(s) 35
SspMI CTAG 1 cut(s) 47
StyD4I CCNGG 2 cut(s) 226, 267
TaqI TCGA 1 cut(s) 102
TasI AATT 1 cut(s) 111
TseI GCWGC 2 cut(s) 28, 68
TspGWI ACGGA 1 cut(s) 53
VpaK11BI GGWCC 1 cut(s) 264
XspI CTAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.