Rh1DG302000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
52873990 .. 52874946
957 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG302000.1

Sequence Viewer

Length: 237 bp
ATGGAAACTACTGAAGCTGTGAGAATGATGATCGCCGGTCCTCATAACCTGAATATTTTCTTTTCAGTTATTGAAGCAAAATTTAAATTACTTTTGCCTGATCTGTTCAACAAGGCTCTTCACCATACTAGTTTTGGTTCTATCAGCTCATTGTTTTCCATTGAAGGTGTTTTAGGAATTTCTAAACAAGTAGCTGCAAGGTTAAGAAAGCTCCTAGCTGAGCGGAAGTTGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.73

Weight (kDa)

10.11

Isoelectric Point (pI)

35.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 223
AciI CCGC 1 cut(s) 223
AcsI RAATTY 2 cut(s) 80, 177
AcuI CTGAAG 1 cut(s) 33
AgsI TTSAA 4 cut(s) 74, 109, 164, 232
AhlI ACTAGT 1 cut(s) 128
AluBI AGCT 5 cut(s) 17, 147, 194, 211, 218
AluI AGCT 5 cut(s) 17, 147, 194, 211, 218
ApeKI GCWGC 1 cut(s) 194
ApoI RAATTY 2 cut(s) 80, 177
Asp700I GAANNNNTTC 1 cut(s) 56
AspS9I GGNCC 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 113
AvaII GGWCC 1 cut(s) 38
BbvI GCAGC 1 cut(s) 181
BcuI ACTAGT 1 cut(s) 128
BfaI CTAG 2 cut(s) 129, 215
BisI GCNGC 1 cut(s) 195
BlpI GCTNAGC 1 cut(s) 219
BlsI GCNGC 1 cut(s) 196
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 38
Bpu1102I GCTNAGC 1 cut(s) 219
Bse118I RCCGGY 1 cut(s) 35
BseMII CTCAG 1 cut(s) 210
BseXI GCAGC 1 cut(s) 181
BsiSI CCGG 1 cut(s) 36
Bsp143I GATC 2 cut(s) 30, 100
Bsp1720I GCTNAGC 1 cut(s) 219
BspACI CCGC 1 cut(s) 223
BspCNI CTCAG 1 cut(s) 211
BspQI GCTCTTC 1 cut(s) 123
BsrBI CCGCTC 1 cut(s) 223
BsrFI RCCGGY 1 cut(s) 35
BssAI RCCGGY 1 cut(s) 35
BssMI GATC 2 cut(s) 30, 100
Bst6I CTCTTC 1 cut(s) 123
BstDEI CTNAG 1 cut(s) 219
BstKTI GATC 2 cut(s) 33, 103
BstMBI GATC 2 cut(s) 30, 100
BstV1I GCAGC 1 cut(s) 181
Cfr10I RCCGGY 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 38
CviJI RGCY 6 cut(s) 17, 116, 147, 194, 211, 218
CviKI_1 RGCY 6 cut(s) 17, 116, 147, 194, 211, 218
DdeI CTNAG 1 cut(s) 219
DpnI GATC 2 cut(s) 32, 102
DpnII GATC 2 cut(s) 30, 100
DraI TTTAAA 1 cut(s) 85
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
Eco47I GGWCC 1 cut(s) 38
Eco57I CTGAAG 1 cut(s) 33
FaiI YATR 2 cut(s) 45, 126
Fnu4HI GCNGC 1 cut(s) 195
Fsp4HI GCNGC 1 cut(s) 195
FspBI CTAG 2 cut(s) 129, 215
GluI GCNGC 1 cut(s) 195
HapII CCGG 1 cut(s) 36
HpaII CCGG 1 cut(s) 36
HphI GGTGA 1 cut(s) 113
HpyAV CCTTC 1 cut(s) 158
HpyCH4V TGCA 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 219
Kzo9I GATC 2 cut(s) 30, 100
LguI GCTCTTC 1 cut(s) 123
LmnI GCTCC 1 cut(s) 216
LpnPI CCDG 3 cut(s) 49, 62, 111
Lsp1109I GCAGC 1 cut(s) 181
MaeI CTAG 2 cut(s) 129, 215
MalI GATC 2 cut(s) 32, 102
MbiI CCGCTC 1 cut(s) 223
MboI GATC 2 cut(s) 30, 100
MboII GAAGA 1 cut(s) 110
MluCI AATT 3 cut(s) 80, 86, 177
MnlI CCTC 1 cut(s) 51
MroXI GAANNNNTTC 1 cut(s) 56
MseI TTAA 2 cut(s) 84, 203
MspI CCGG 1 cut(s) 36
NdeII GATC 2 cut(s) 30, 100
PciSI GCTCTTC 1 cut(s) 123
PdmI GAANNNNTTC 1 cut(s) 56
PkrI GCNGC 1 cut(s) 196
PspPI GGNCC 1 cut(s) 38
SapI GCTCTTC 1 cut(s) 123
SaqAI TTAA 2 cut(s) 84, 203
SatI GCNGC 1 cut(s) 195
Sau3AI GATC 2 cut(s) 30, 100
Sau96I GGNCC 1 cut(s) 38
SetI ASST 8 cut(s) 19, 51, 149, 169, 196, 203, 213, 220
SgeI CNNG 8 cut(s) 48, 61, 110, 124, 141, 200, 210, 227
SinI GGWCC 1 cut(s) 38
SmiI ATTTAAAT 1 cut(s) 85
SpeI ACTAGT 1 cut(s) 128
Sse9I AATT 3 cut(s) 80, 86, 177
SsiI CCGC 1 cut(s) 223
SspI AATATT 1 cut(s) 55
SspMI CTAG 2 cut(s) 129, 215
SwaI ATTTAAAT 1 cut(s) 85
TasI AATT 3 cut(s) 80, 86, 177
Tru1I TTAA 2 cut(s) 84, 203
Tru9I TTAA 2 cut(s) 84, 203
TseI GCWGC 1 cut(s) 194
VpaK11BI GGWCC 1 cut(s) 38
XapI RAATTY 2 cut(s) 80, 177
XcmI CCANNNNNNNNNTGG 1 cut(s) 131
XmnI GAANNNNTTC 1 cut(s) 56
XspI CTAG 2 cut(s) 129, 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.