Rh6BG326600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
55851731 .. 55854734
3004 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG326600.1

Sequence Viewer

Length: 327 bp
ATGGCTGGAGGGCTGTTGGAAGATATTGATCTGAGCATGATGATGATCTCAGAACTTTCGGGGGTTTCCGACACCCAAGAGCGAGTGAGAAACCAATCAAGGAGAAGACATGCTATTACTTTATTTTTGAAGTTATTGAAGCAAAATTTAAAATATGTCTCAGCCTCATTAATTAATTCACTCCATGTAATTGATTTTGTTGCTCATATCATCGAGAAGGAAATATTGTTTCCAATGCCATTGACATTTGCGGATGGGATCAAGAATACAAACAAGAGGCTACATACAAAGAGCCACCCCTACAACAACTCAAACCTAGCTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.28

Weight (kDa)

9.45

Isoelectric Point (pI)

48.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 251
AclWI GGATC 1 cut(s) 266
AcsI RAATTY 1 cut(s) 145
AgsI TTSAA 2 cut(s) 130, 139
AluBI AGCT 1 cut(s) 320
AluI AGCT 1 cut(s) 320
Alw26I GTCTC 1 cut(s) 163
AlwI GGATC 1 cut(s) 266
ApoI RAATTY 1 cut(s) 145
AseI ATTAAT 2 cut(s) 170, 174
BbsI GAAGAC 1 cut(s) 112
BccI CCATC 1 cut(s) 248
BcoDI GTCTC 1 cut(s) 163
BfaI CTAG 1 cut(s) 317
BpiI GAAGAC 1 cut(s) 112
BpmI CTGGAG 1 cut(s) 27
BsaBI GATNNNNATC 2 cut(s) 27, 44
Bse8I GATNNNNATC 2 cut(s) 27, 44
BseGI GGATG 1 cut(s) 259
BseJI GATNNNNATC 2 cut(s) 27, 44
BseMII CTCAG 3 cut(s) 23, 63, 174
BsmAI GTCTC 1 cut(s) 163
Bsp143I GATC 3 cut(s) 28, 45, 258
BspACI CCGC 1 cut(s) 251
BspCNI CTCAG 3 cut(s) 24, 62, 173
BspPI GGATC 1 cut(s) 266
BssMI GATC 3 cut(s) 28, 45, 258
BstDEI CTNAG 3 cut(s) 32, 49, 160
BstF5I GGATG 1 cut(s) 259
BstKTI GATC 3 cut(s) 31, 48, 261
BstMAI GTCTC 1 cut(s) 163
BstMBI GATC 3 cut(s) 28, 45, 258
BstNSI RCATGY 1 cut(s) 113
BstV2I GAAGAC 1 cut(s) 112
BtsCI GGATG 1 cut(s) 259
CviAII CATG 3 cut(s) 37, 110, 185
CviJI RGCY 6 cut(s) 5, 13, 164, 280, 294, 320
CviKI_1 RGCY 6 cut(s) 5, 13, 164, 280, 294, 320
DdeI CTNAG 3 cut(s) 32, 49, 160
DpnI GATC 3 cut(s) 30, 47, 260
DpnII GATC 3 cut(s) 28, 45, 258
DraI TTTAAA 1 cut(s) 150
FaeI CATG 3 cut(s) 40, 113, 188
FaiI YATR 6 cut(s) 38, 111, 156, 186, 207, 285
FatI CATG 3 cut(s) 36, 109, 184
FokI GGATG 1 cut(s) 266
FspBI CTAG 1 cut(s) 317
GsuI CTGGAG 1 cut(s) 27
Hin1II CATG 3 cut(s) 40, 113, 188
Hpy188I TCNGA 3 cut(s) 33, 52, 70
Hpy188III TCNNGA 2 cut(s) 214, 262
HpyAV CCTTC 1 cut(s) 211
HpyF3I CTNAG 3 cut(s) 32, 49, 160
Hsp92II CATG 3 cut(s) 40, 113, 188
Kzo9I GATC 3 cut(s) 28, 45, 258
MaeI CTAG 1 cut(s) 317
MalI GATC 3 cut(s) 30, 47, 260
MboI GATC 3 cut(s) 28, 45, 258
MboII GAAGA 2 cut(s) 32, 117
MluCI AATT 5 cut(s) 145, 171, 175, 189, 322
MmeI TCCRAC 1 cut(s) 93
MnlI CCTC 2 cut(s) 175, 270
MseI TTAA 4 cut(s) 149, 170, 174, 325
MslI CAYNNNNRTG 1 cut(s) 41
NdeII GATC 3 cut(s) 28, 45, 258
NlaIII CATG 3 cut(s) 40, 113, 188
NspI RCATGY 1 cut(s) 113
PacI TTAATTAA 1 cut(s) 174
PshBI ATTAAT 2 cut(s) 170, 174
RseI CAYNNNNRTG 1 cut(s) 41
SaqAI TTAA 4 cut(s) 149, 170, 174, 325
Sau3AI GATC 3 cut(s) 28, 45, 258
SetI ASST 2 cut(s) 318, 322
SmiMI CAYNNNNRTG 1 cut(s) 41
Sse9I AATT 5 cut(s) 145, 171, 175, 189, 322
SsiI CCGC 1 cut(s) 251
SspI AATATT 1 cut(s) 225
SspMI CTAG 1 cut(s) 317
TaqI TCGA 1 cut(s) 213
TasI AATT 5 cut(s) 145, 171, 175, 189, 322
Tru1I TTAA 4 cut(s) 149, 170, 174, 325
Tru9I TTAA 4 cut(s) 149, 170, 174, 325
VspI ATTAAT 2 cut(s) 170, 174
XapI RAATTY 1 cut(s) 145
XceI RCATGY 1 cut(s) 113
XspI CTAG 1 cut(s) 317
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.