Rh6DG318300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
52049178 .. 52052177
3000 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG318300.1

Sequence Viewer

Length: 270 bp
ATGGCTGGAGGGCTGTTGGAAGATATTGATCTGAGCATGATGATGATCTCAGAACTTTCGGGGGTTTCCGACACCCAAGAGTTATTGAAGCAAAATTTAAAGTTACTTTTGCCTGATCTGTTCAACAAGGCTCTTCACCATACTGGTTTTGGTTCTATCAGCTCATTGTTTTCCATTGAAGGTGTTTTAGGAATTTCTAAACAAGTAGCTGCAAGAATACAAACAAGAGGCTACATACAAAGAGCCACCCCTACAACAACTCAAACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.65

Weight (kDa)

6.03

Isoelectric Point (pI)

23.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 94, 192
AgsI TTSAA 3 cut(s) 88, 124, 179
AluBI AGCT 2 cut(s) 162, 209
AluI AGCT 2 cut(s) 162, 209
ApeKI GCWGC 1 cut(s) 209
ApoI RAATTY 2 cut(s) 94, 192
AsuHPI GGTGA 1 cut(s) 128
BbvI GCAGC 1 cut(s) 196
BfaI CTAG 1 cut(s) 268
BisI GCNGC 1 cut(s) 210
BlsI GCNGC 1 cut(s) 211
BpmI CTGGAG 1 cut(s) 27
BsaBI GATNNNNATC 2 cut(s) 27, 44
Bse1I ACTGG 1 cut(s) 148
Bse8I GATNNNNATC 2 cut(s) 27, 44
BseJI GATNNNNATC 2 cut(s) 27, 44
BseMII CTCAG 2 cut(s) 23, 63
BseNI ACTGG 1 cut(s) 148
BseXI GCAGC 1 cut(s) 196
Bsp143I GATC 3 cut(s) 28, 45, 115
BspCNI CTCAG 2 cut(s) 24, 62
BspQI GCTCTTC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 148
BssMI GATC 3 cut(s) 28, 45, 115
Bst6I CTCTTC 1 cut(s) 138
BstDEI CTNAG 2 cut(s) 32, 49
BstKTI GATC 3 cut(s) 31, 48, 118
BstMBI GATC 3 cut(s) 28, 45, 115
BstV1I GCAGC 1 cut(s) 196
CviAII CATG 1 cut(s) 37
CviJI RGCY 7 cut(s) 5, 13, 131, 162, 209, 231, 245
CviKI_1 RGCY 7 cut(s) 5, 13, 131, 162, 209, 231, 245
DdeI CTNAG 2 cut(s) 32, 49
DpnI GATC 3 cut(s) 30, 47, 117
DpnII GATC 3 cut(s) 28, 45, 115
DraI TTTAAA 1 cut(s) 99
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
FaeI CATG 1 cut(s) 40
FaiI YATR 3 cut(s) 38, 141, 236
FatI CATG 1 cut(s) 36
Fnu4HI GCNGC 1 cut(s) 210
Fsp4HI GCNGC 1 cut(s) 210
FspBI CTAG 1 cut(s) 268
GluI GCNGC 1 cut(s) 210
GsuI CTGGAG 1 cut(s) 27
Hin1II CATG 1 cut(s) 40
HphI GGTGA 1 cut(s) 128
Hpy188I TCNGA 3 cut(s) 33, 52, 70
HpyAV CCTTC 1 cut(s) 173
HpyCH4V TGCA 1 cut(s) 212
HpyF3I CTNAG 2 cut(s) 32, 49
Hsp92II CATG 1 cut(s) 40
Kzo9I GATC 3 cut(s) 28, 45, 115
LguI GCTCTTC 1 cut(s) 138
LpnPI CCDG 2 cut(s) 126, 129
Lsp1109I GCAGC 1 cut(s) 196
MaeI CTAG 1 cut(s) 268
MaeIII GTNAC 1 cut(s) 102
MalI GATC 3 cut(s) 30, 47, 117
MboI GATC 3 cut(s) 28, 45, 115
MboII GAAGA 2 cut(s) 32, 125
MluCI AATT 2 cut(s) 94, 192
MmeI TCCRAC 1 cut(s) 93
MnlI CCTC 1 cut(s) 221
MseI TTAA 1 cut(s) 98
MslI CAYNNNNRTG 1 cut(s) 41
NdeII GATC 3 cut(s) 28, 45, 115
NlaIII CATG 1 cut(s) 40
PciSI GCTCTTC 1 cut(s) 138
PkrI GCNGC 1 cut(s) 211
RseI CAYNNNNRTG 1 cut(s) 41
SapI GCTCTTC 1 cut(s) 138
SaqAI TTAA 1 cut(s) 98
SatI GCNGC 1 cut(s) 210
Sau3AI GATC 3 cut(s) 28, 45, 115
SetI ASST 4 cut(s) 164, 184, 211, 269
SmiMI CAYNNNNRTG 1 cut(s) 41
Sse9I AATT 2 cut(s) 94, 192
SspMI CTAG 1 cut(s) 268
TasI AATT 2 cut(s) 94, 192
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TseI GCWGC 1 cut(s) 209
XapI RAATTY 2 cut(s) 94, 192
XcmI CCANNNNNNNNNTGG 1 cut(s) 146
XspI CTAG 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.