Rh2AG310300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
39486880 .. 39488598
1719 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG310300.1

Sequence Viewer

Length: 333 bp
ATGGTGATTTCCTTATATGACATTATGACCATAGCCTTCTTAATTGAACGAAAGGAATTATCTCAGAGACCGTCTGCTAGCAAATTCATCGGGATGAGTGTTTGGGATTATCATCCCTGGAAAGTTGTAGCAGTATGCTGGAAAAGTAGACGTTGCTTTGTAAGGCTACAAGAACTCGCAACAGGGTTACAAAGCCAAGTGGCTAGTCAGCAACTAAGCAGTGCCTTTAATTGTTCTACTCCACTCCTATTACCTGAAATCCCACTATCAGGACTTTCAGACCGTGAAACAAGTCTGCTCTTATCCTTTCTCAGTCTGCTACTACAAGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.39

Weight (kDa)

8.57

Isoelectric Point (pI)

58.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012639)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 148
AcsI RAATTY 1 cut(s) 83
AfiI CCNNNNNNNGG 1 cut(s) 269
AgsI TTSAA 1 cut(s) 47
AjnI CCWGG 1 cut(s) 116
Alw26I GTCTC 1 cut(s) 61
ApoI RAATTY 1 cut(s) 83
AsuHPI GGTGA 1 cut(s) 16
AsuNHI GCTAGC 1 cut(s) 77
BcgI CGANNNNNNTGC 2 cut(s) 70, 104
BciT130I CCWGG 1 cut(s) 118
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 2 cut(s) 78, 204
Bme1390I CCNGG 1 cut(s) 118
BmrFI CCNGG 1 cut(s) 118
BmtI GCTAGC 1 cut(s) 81
BsaBI GATNNNNATC 1 cut(s) 111
BsaI GGTCTC 1 cut(s) 61
BsaJI CCNNGG 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 269
Bse8I GATNNNNATC 1 cut(s) 111
BseBI CCWGG 1 cut(s) 118
BseDI CCNNGG 1 cut(s) 116
BseGI GGATG 2 cut(s) 99, 112
BseJI GATNNNNATC 1 cut(s) 111
BseLI CCNNNNNNNGG 1 cut(s) 269
BseMII CTCAG 2 cut(s) 77, 325
BslI CCNNNNNNNGG 1 cut(s) 269
BsmAI GTCTC 1 cut(s) 61
Bso31I GGTCTC 1 cut(s) 61
BspCNI CTCAG 2 cut(s) 76, 324
BspOI GCTAGC 1 cut(s) 81
BspTNI GGTCTC 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 116
Bst2UI CCWGG 1 cut(s) 118
Bst4CI ACNGT 2 cut(s) 72, 284
BstC8I GCNNGC 1 cut(s) 79
BstDEI CTNAG 3 cut(s) 63, 215, 311
BstF5I GGATG 2 cut(s) 99, 112
BstMAI GTCTC 1 cut(s) 61
BstNI CCWGG 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 116
BtsCI GGATG 2 cut(s) 99, 112
BtsI GCAGTG 1 cut(s) 226
BtsIMutI CAGTG 1 cut(s) 226
Cac8I GCNNGC 1 cut(s) 79
CviJI RGCY 4 cut(s) 35, 166, 195, 203
CviKI_1 RGCY 4 cut(s) 35, 166, 195, 203
DdeI CTNAG 3 cut(s) 63, 215, 311
Eco31I GGTCTC 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 116
FaiI YATR 5 cut(s) 16, 18, 26, 32, 136
FblI GTMKAC 1 cut(s) 148
FokI GGATG 2 cut(s) 99, 106
FspBI CTAG 2 cut(s) 78, 204
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 149
Hpy188I TCNGA 2 cut(s) 66, 280
Hpy188III TCNNGA 2 cut(s) 91, 270
Hpy8I GTNNAC 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 2 cut(s) 72, 284
HpyCH4IV ACGT 1 cut(s) 151
HpyF3I CTNAG 3 cut(s) 63, 215, 311
HpySE526I ACGT 1 cut(s) 151
LpnPI CCDG 6 cut(s) 103, 124, 130, 168, 255, 267
MaeI CTAG 2 cut(s) 78, 204
MaeII ACGT 1 cut(s) 151
MaeIII GTNAC 1 cut(s) 186
MluCI AATT 4 cut(s) 42, 56, 83, 229
MseI TTAA 2 cut(s) 41, 228
MslI CAYNNNNRTG 1 cut(s) 92
MspR9I CCNGG 1 cut(s) 118
MvaI CCWGG 1 cut(s) 118
NheI GCTAGC 1 cut(s) 77
Psp6I CCWGG 1 cut(s) 116
PspGI CCWGG 1 cut(s) 116
RseI CAYNNNNRTG 1 cut(s) 92
SaqAI TTAA 2 cut(s) 41, 228
ScrFI CCNGG 1 cut(s) 118
SetI ASST 3 cut(s) 154, 256, 331
SmiMI CAYNNNNRTG 1 cut(s) 92
Sse9I AATT 4 cut(s) 42, 56, 83, 229
SspMI CTAG 2 cut(s) 78, 204
StyD4I CCNGG 1 cut(s) 116
TaaI ACNGT 2 cut(s) 72, 284
TaiI ACGT 1 cut(s) 154
TasI AATT 4 cut(s) 42, 56, 83, 229
Tru1I TTAA 2 cut(s) 41, 228
Tru9I TTAA 2 cut(s) 41, 228
TscAI CASTG 1 cut(s) 226
TspDTI ATGAA 1 cut(s) 76
TspRI CASTG 1 cut(s) 226
XapI RAATTY 1 cut(s) 83
XmiI GTMKAC 1 cut(s) 148
XspI CTAG 2 cut(s) 78, 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.