Rh2CG238700
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
24717998 .. 24718444
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG238700.1

Sequence Viewer

Length: 447 bp
ATGTACGCGTTTCCAGGGAATGTAGACATCTTCTTTCTCGAATTTTCGTTGCTAACCCCGAAAAGGTTTTACTACTCCTTAGAACATAGCGAGCAATGGAATGTCTGTCTGTTGATGCACATTCAATTTGAATCATTAAATTTTATACCTGAACTCCTGAATTCTATGCAGAGAATAACAATCCCAGAGATAAAGCAGCACCCCTGGTTTCTAAAAAATTTACCAGAGGAATTCATGGATGAAGACAGCCTGCAAATTGGTGATGATCAAAAAAATGAAACCTCCCAAAGTGTTGAAGAAATAGTGTCCATTATTCAAGAGGCTCGAAAAGCTGGTGATGGCATCAAAGTTGGTGGACATTTTCTTGGAAGTATGGACCTTGATGAGATAGATGATACTGACATCGATGATATAGAAACAAGTGGTGATTTTGTATGTGCATTGTGA

Protein Analysis

148

Amino Acids

17.07

Weight (kDa)

4.17

Isoelectric Point (pI)

50.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 24
AccII CGCG 1 cut(s) 8
AcsI RAATTY 5 cut(s) 41, 139, 160, 217, 230
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 63
AflIII ACRYGT 1 cut(s) 6
AgsI TTSAA 4 cut(s) 125, 131, 296, 317
AjnI CCWGG 2 cut(s) 13, 203
AluBI AGCT 1 cut(s) 332
AluI AGCT 1 cut(s) 332
ApeKI GCWGC 1 cut(s) 196
ApoI RAATTY 5 cut(s) 41, 139, 160, 217, 230
AspS9I GGNCC 1 cut(s) 376
AsuHPI GGTGA 3 cut(s) 272, 347, 437
AvaII GGWCC 1 cut(s) 376
BbsI GAAGAC 1 cut(s) 249
BbvI GCAGC 1 cut(s) 208
BccI CCATC 1 cut(s) 332
BciT130I CCWGG 2 cut(s) 15, 205
BclI TGATCA 1 cut(s) 265
BisI GCNGC 1 cut(s) 197
BlsI GCNGC 1 cut(s) 198
Bme1390I CCNGG 2 cut(s) 15, 205
Bme18I GGWCC 1 cut(s) 376
BmgT120I GGNCC 1 cut(s) 376
BmrFI CCNGG 2 cut(s) 15, 205
BmsI GCATC 2 cut(s) 105, 351
BpiI GAAGAC 1 cut(s) 249
Bsa29I ATCGAT 1 cut(s) 405
BsaJI CCNNGG 2 cut(s) 14, 203
BsaXI ACNNNNNCTCC 2 cut(s) 138, 168
Bsc4I CCNNNNNNNGG 1 cut(s) 63
Bse3DI GCAATG 1 cut(s) 101
BseBI CCWGG 2 cut(s) 15, 205
BseCI ATCGAT 1 cut(s) 405
BseDI CCNNGG 2 cut(s) 14, 203
BseGI GGATG 1 cut(s) 244
BseLI CCNNNNNNNGG 1 cut(s) 63
BseMI GCAATG 1 cut(s) 101
BseXI GCAGC 1 cut(s) 208
Bsh1236I CGCG 1 cut(s) 8
BshVI ATCGAT 1 cut(s) 405
BslI CCNNNNNNNGG 1 cut(s) 63
Bsp143I GATC 1 cut(s) 265
BspDI ATCGAT 1 cut(s) 405
BspFNI CGCG 1 cut(s) 8
BsrDI GCAATG 1 cut(s) 101
BssECI CCNNGG 2 cut(s) 14, 203
BssMI GATC 1 cut(s) 265
Bst2UI CCWGG 2 cut(s) 15, 205
BstC8I GCNNGC 2 cut(s) 92, 251
BstDEI CTNAG 1 cut(s) 79
BstF5I GGATG 1 cut(s) 244
BstFNI CGCG 1 cut(s) 8
BstKTI GATC 1 cut(s) 268
BstMBI GATC 1 cut(s) 265
BstMWI GCNNNNNNNGC 1 cut(s) 329
BstNI CCWGG 2 cut(s) 15, 205
BstSCI CCNGG 2 cut(s) 13, 203
BstUI CGCG 1 cut(s) 8
BstV1I GCAGC 1 cut(s) 208
BstV2I GAAGAC 1 cut(s) 249
Bsu15I ATCGAT 1 cut(s) 405
BsuTUI ATCGAT 1 cut(s) 405
BtsCI GGATG 1 cut(s) 244
Cac8I GCNNGC 2 cut(s) 92, 251
Cfr13I GGNCC 1 cut(s) 376
ClaI ATCGAT 1 cut(s) 405
Csp6I GTAC 1 cut(s) 4
CspCI CAANNNNNGTGG 2 cut(s) 334, 369
CviAII CATG 1 cut(s) 235
CviJI RGCY 3 cut(s) 249, 323, 332
CviKI_1 RGCY 3 cut(s) 249, 323, 332
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 79
DpnI GATC 1 cut(s) 267
DpnII GATC 1 cut(s) 265
Eco47I GGWCC 1 cut(s) 376
EcoRI GAATTC 2 cut(s) 160, 230
EcoRII CCWGG 2 cut(s) 13, 203
FaeI CATG 1 cut(s) 238
FaiI YATR 7 cut(s) 87, 146, 167, 236, 374, 413, 436
FatI CATG 1 cut(s) 234
FbaI TGATCA 1 cut(s) 265
FblI GTMKAC 1 cut(s) 24
Fnu4HI GCNGC 1 cut(s) 197
FokI GGATG 1 cut(s) 251
Fsp4HI GCNGC 1 cut(s) 197
GluI GCNGC 1 cut(s) 197
Hin1II CATG 1 cut(s) 238
HinfI GANTC 1 cut(s) 131
HphI GGTGA 3 cut(s) 272, 347, 437
Hpy166II GTNNAC 2 cut(s) 25, 356
Hpy188III TCNNGA 3 cut(s) 38, 157, 317
Hpy8I GTNNAC 2 cut(s) 25, 356
HpyCH4V TGCA 4 cut(s) 118, 169, 253, 440
HpyF10VI GCNNNNNNNGC 1 cut(s) 329
HpyF3I CTNAG 1 cut(s) 79
Hsp92II CATG 1 cut(s) 238
Ksp22I TGATCA 1 cut(s) 265
Kzo9I GATC 1 cut(s) 265
LpnPI CCDG 9 cut(s) 27, 162, 170, 190, 198, 217, 237, 263, 318
Lsp1109I GCAGC 1 cut(s) 208
LweI GCATC 2 cut(s) 105, 351
MalI GATC 1 cut(s) 267
MboI GATC 1 cut(s) 265
MboII GAAGA 3 cut(s) 22, 254, 308
MluCI AATT 7 cut(s) 41, 125, 139, 160, 217, 230, 255
MluI ACGCGT 1 cut(s) 6
MnlI CCTC 3 cut(s) 220, 292, 313
MseI TTAA 1 cut(s) 137
MspR9I CCNGG 2 cut(s) 15, 205
MvaI CCWGG 2 cut(s) 15, 205
MvnI CGCG 1 cut(s) 8
MwoI GCNNNNNNNGC 1 cut(s) 329
NdeII GATC 1 cut(s) 265
NlaIII CATG 1 cut(s) 238
PfeI GAWTC 1 cut(s) 131
PkrI GCNGC 1 cut(s) 198
Psp6I CCWGG 2 cut(s) 13, 203
PspGI CCWGG 2 cut(s) 13, 203
PspPI GGNCC 1 cut(s) 376
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 137
SatI GCNGC 1 cut(s) 197
Sau3AI GATC 1 cut(s) 265
Sau96I GGNCC 1 cut(s) 376
ScrFI CCNGG 2 cut(s) 15, 205
SetI ASST 5 cut(s) 68, 151, 284, 334, 381
SfaNI GCATC 2 cut(s) 105, 351
SinI GGWCC 1 cut(s) 376
Sse9I AATT 7 cut(s) 41, 125, 139, 160, 217, 230, 255
StyD4I CCNGG 2 cut(s) 13, 203
TaqI TCGA 3 cut(s) 39, 325, 405
TasI AATT 7 cut(s) 41, 125, 139, 160, 217, 230, 255
TfiI GAWTC 1 cut(s) 131
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TseI GCWGC 1 cut(s) 196
TspDTI ATGAA 3 cut(s) 223, 255, 291
VpaK11BI GGWCC 1 cut(s) 376
XapI RAATTY 5 cut(s) 41, 139, 160, 217, 230
XmiI GTMKAC 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.