Rh2DG053300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
3835546 .. 3836731
1186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG053300.1

Sequence Viewer

Length: 270 bp
ATGGTGCTCAGAAATTCCATTTCCAACACCAAGAGGTTTTTTCAGAAAACCCTTGGGAACCTGAAGAACCTATTTTCTGCTGGTAGCTACGAAAAGCTACCCAAATCGCCTGCCATCTATAATCTCTATAGTACATCTATATCTACTAGTACTTTTGCTCGTGTTCATGATATGAATATCCACAATACAAGCAGTTACAAAGACTTGGACAAGTTGTACAACGACTTCACAGATCAATGGGATAGCAAGAGACCAAAGCCAAGAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.36

Weight (kDa)

9.74

Isoelectric Point (pI)

36.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010815)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 13
AcuI CTGAAG 1 cut(s) 83
AfaI GTAC 3 cut(s) 133, 151, 218
AhlI ACTAGT 1 cut(s) 146
AluBI AGCT 2 cut(s) 87, 97
AluI AGCT 2 cut(s) 87, 97
Alw21I GWGCWC 1 cut(s) 9
Alw26I GTCTC 1 cut(s) 244
ApoI RAATTY 1 cut(s) 13
BarI GAAGNNNNNNTAC 2 cut(s) 209, 241
BauI CACGAG 1 cut(s) 159
Bbv12I GWGCWC 1 cut(s) 9
BccI CCATC 1 cut(s) 122
BcoDI GTCTC 1 cut(s) 244
BcuI ACTAGT 1 cut(s) 146
BfaI CTAG 1 cut(s) 147
BfmI CTRYAG 1 cut(s) 127
BmcAI AGTACT 1 cut(s) 151
BmiI GGNNCC 1 cut(s) 59
BsaI GGTCTC 1 cut(s) 244
BsaJI CCNNGG 1 cut(s) 52
BseDI CCNNGG 1 cut(s) 52
BseMII CTCAG 1 cut(s) 22
BsiHKAI GWGCWC 1 cut(s) 9
BsmAI GTCTC 1 cut(s) 244
Bso31I GGTCTC 1 cut(s) 244
Bsp1286I GDGCHC 1 cut(s) 9
Bsp1407I TGTACA 1 cut(s) 216
Bsp143I GATC 1 cut(s) 232
BspCNI CTCAG 1 cut(s) 21
BspHI TCATGA 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 244
BsrGI TGTACA 1 cut(s) 216
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 1 cut(s) 232
BssSI CACGAG 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 52
Bst2BI CACGAG 1 cut(s) 159
BstAUI TGTACA 1 cut(s) 216
BstC8I GCNNGC 1 cut(s) 111
BstDEI CTNAG 1 cut(s) 8
BstKTI GATC 1 cut(s) 235
BstMAI GTCTC 1 cut(s) 244
BstMBI GATC 1 cut(s) 232
BstSFI CTRYAG 1 cut(s) 127
Cac8I GCNNGC 1 cut(s) 111
CciI TCATGA 1 cut(s) 166
Csp6I GTAC 3 cut(s) 132, 150, 217
CviAII CATG 1 cut(s) 167
CviJI RGCY 3 cut(s) 87, 97, 259
CviKI_1 RGCY 3 cut(s) 87, 97, 259
CviQI GTAC 3 cut(s) 132, 150, 217
DdeI CTNAG 1 cut(s) 8
DpnI GATC 1 cut(s) 234
DpnII GATC 1 cut(s) 232
Eco130I CCWWGG 1 cut(s) 52
Eco31I GGTCTC 1 cut(s) 244
Eco57I CTGAAG 1 cut(s) 83
EcoT14I CCWWGG 1 cut(s) 52
ErhI CCWWGG 1 cut(s) 52
FaeI CATG 1 cut(s) 170
FaiI YATR 5 cut(s) 120, 129, 140, 168, 173
FatI CATG 1 cut(s) 166
FspBI CTAG 1 cut(s) 147
Hin1II CATG 1 cut(s) 170
Hpy188I TCNGA 2 cut(s) 11, 45
Hpy188III TCNNGA 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 8
Hsp92II CATG 1 cut(s) 170
Kzo9I GATC 1 cut(s) 232
LpnPI CCDG 3 cut(s) 66, 74, 123
MaeI CTAG 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 194
MalI GATC 1 cut(s) 234
MboI GATC 1 cut(s) 232
MboII GAAGA 1 cut(s) 76
MhlI GDGCHC 1 cut(s) 9
MluCI AATT 1 cut(s) 13
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 1 cut(s) 27
NdeII GATC 1 cut(s) 232
NlaIII CATG 1 cut(s) 170
NlaIV GGNNCC 1 cut(s) 59
PagI TCATGA 1 cut(s) 166
PspN4I GGNNCC 1 cut(s) 59
RsaI GTAC 3 cut(s) 133, 151, 218
RsaNI GTAC 3 cut(s) 132, 150, 217
Sau3AI GATC 1 cut(s) 232
ScaI AGTACT 1 cut(s) 151
SduI GDGCHC 1 cut(s) 9
SetI ASST 5 cut(s) 38, 63, 72, 89, 99
SfcI CTRYAG 1 cut(s) 127
SpeI ACTAGT 1 cut(s) 146
Sse9I AATT 1 cut(s) 13
SspMI CTAG 1 cut(s) 147
StyI CCWWGG 1 cut(s) 52
TasI AATT 1 cut(s) 13
TatI WGTACW 3 cut(s) 131, 149, 216
TspDTI ATGAA 2 cut(s) 155, 188
XapI RAATTY 1 cut(s) 13
XspI CTAG 1 cut(s) 147
ZrmI AGTACT 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.