Rh2DG053500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
3853472 .. 3855527
2056 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG053500.1

Sequence Viewer

Length: 654 bp
ATGGTGCTTAGAAATTCCATTTCCAACACCAAGAGGTTTTTTCAGAAAACCCTTGGGAACCTGAAGAACCTATTTTCTGCTGGTAGCTATGAAAAGCTACCCAAATCCCCTGCCACCTATAATCCCTATAGTACTTCTATGTCTACTAGTACTTTTGCTCGTGTTCATGATATGAATATCCACAACACAAGCAGTTACAAAGACTTGGACAAGTTGTACAACGACTTCACAGATCAATGGGATAGCAAGAGACAAAGCAACAACAAGAGATTAGTAATTTCCTCGCACGCCCAGCAAGATCATAAAGTGGTTCAAAGGAGAGATCATGAGGCATGTGATCGTAATAACAAGGTGATGACAAAGAGAGTGGAGGAAAGTAGAACTACGTTTTCCAATGAATTGAAAGAGCCGAAAAGGGGTTGTTTGGTGGCTGAGAAGTTGAAGGAGTTGGAGATGTTGGATATAAGCAATGTAGATCATGTTCTGGATGTACAAGAAGTGTTTCATTACTACTCTCGCCTCACTTGCCCTGCCTATCTTGAAATCGTGGACAGGTTCTTCATGGAAATGTGTGCTGAATTTTTCGGTCCAGCAGCAACCCCAGGAAGAAGCAAGAAGTCAAGGCTGAGGCCAAGGACTTCTTTGAGGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

217

Amino Acids

25.29

Weight (kDa)

9.47

Isoelectric Point (pI)

58.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010815)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 143
AcsI RAATTY 2 cut(s) 13, 578
AcuI CTGAAG 1 cut(s) 83
AfaI GTAC 4 cut(s) 133, 151, 218, 492
AfiI CCNNNNNNNGG 1 cut(s) 416
AgsI TTSAA 4 cut(s) 314, 403, 442, 542
AhlI ACTAGT 1 cut(s) 146
AjnI CCWGG 1 cut(s) 601
AluBI AGCT 2 cut(s) 87, 97
AluI AGCT 2 cut(s) 87, 97
Alw26I GTCTC 1 cut(s) 244
AoxI GGCC 1 cut(s) 629
ApeKI GCWGC 1 cut(s) 593
ApoI RAATTY 2 cut(s) 13, 578
Asp700I GAANNNNTTC 1 cut(s) 501
AspS9I GGNCC 1 cut(s) 587
AsuHPI GGTGA 1 cut(s) 364
AvaII GGWCC 1 cut(s) 587
BarI GAAGNNNNNNTAC 2 cut(s) 209, 241
BauI CACGAG 1 cut(s) 159
BbvCI CCTCAGC 1 cut(s) 626
BbvI GCAGC 1 cut(s) 605
BciT130I CCWGG 1 cut(s) 603
BcoDI GTCTC 1 cut(s) 244
BcuI ACTAGT 1 cut(s) 146
BfaI CTAG 1 cut(s) 147
BfmI CTRYAG 1 cut(s) 127
BisI GCNGC 1 cut(s) 594
BlsI GCNGC 1 cut(s) 595
BmcAI AGTACT 2 cut(s) 133, 151
Bme1390I CCNGG 1 cut(s) 603
Bme18I GGWCC 1 cut(s) 587
BmgT120I GGNCC 1 cut(s) 587
BmiI GGNNCC 1 cut(s) 59
BmrFI CCNGG 1 cut(s) 603
Bpu10I CCTNAGC 1 cut(s) 626
BsaJI CCNNGG 3 cut(s) 52, 601, 632
Bsc4I CCNNNNNNNGG 1 cut(s) 416
Bse3DI GCAATG 1 cut(s) 475
BseBI CCWGG 1 cut(s) 603
BseDI CCNNGG 3 cut(s) 52, 601, 632
BseGI GGATG 1 cut(s) 493
BseLI CCNNNNNNNGG 1 cut(s) 416
BseMI GCAATG 1 cut(s) 475
BseMII CTCAG 2 cut(s) 423, 617
BseXI GCAGC 1 cut(s) 605
BseYI CCCAGC 1 cut(s) 291
BshFI GGCC 1 cut(s) 631
BslI CCNNNNNNNGG 1 cut(s) 416
BsmAI GTCTC 1 cut(s) 244
BsnI GGCC 1 cut(s) 631
Bsp1407I TGTACA 2 cut(s) 216, 490
Bsp143I GATC 5 cut(s) 232, 298, 322, 337, 475
BspANI GGCC 1 cut(s) 631
BspCNI CTCAG 2 cut(s) 424, 618
BspHI TCATGA 2 cut(s) 166, 325
BspLI GGNNCC 1 cut(s) 59
BsrDI GCAATG 1 cut(s) 475
BsrGI TGTACA 2 cut(s) 216, 490
BssECI CCNNGG 3 cut(s) 52, 601, 632
BssMI GATC 5 cut(s) 232, 298, 322, 337, 475
BssSI CACGAG 1 cut(s) 159
BssT1I CCWWGG 2 cut(s) 52, 632
Bst2BI CACGAG 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 603
BstAUI TGTACA 2 cut(s) 216, 490
BstC8I GCNNGC 1 cut(s) 288
BstDEI CTNAG 3 cut(s) 8, 432, 626
BstF5I GGATG 1 cut(s) 493
BstKTI GATC 5 cut(s) 235, 301, 325, 340, 478
BstMAI GTCTC 1 cut(s) 244
BstMBI GATC 5 cut(s) 232, 298, 322, 337, 475
BstMWI GCNNNNNNNGC 2 cut(s) 292, 525
BstNI CCWGG 1 cut(s) 603
BstNSI RCATGY 1 cut(s) 336
BstSCI CCNGG 1 cut(s) 601
BstSFI CTRYAG 1 cut(s) 127
BstV1I GCAGC 1 cut(s) 605
BsuRI GGCC 1 cut(s) 631
BtsCI GGATG 1 cut(s) 493
Cac8I GCNNGC 1 cut(s) 288
CciI TCATGA 2 cut(s) 166, 325
Cfr13I GGNCC 1 cut(s) 587
Csp6I GTAC 4 cut(s) 132, 150, 217, 491
CspCI CAANNNNNGTGG 2 cut(s) 348, 383
CviAII CATG 5 cut(s) 167, 326, 333, 479, 562
CviJI RGCY 6 cut(s) 87, 97, 409, 431, 625, 631
CviKI_1 RGCY 6 cut(s) 87, 97, 409, 431, 625, 631
CviQI GTAC 4 cut(s) 132, 150, 217, 491
DdeI CTNAG 3 cut(s) 8, 432, 626
DpnI GATC 5 cut(s) 234, 300, 324, 339, 477
DpnII GATC 5 cut(s) 232, 298, 322, 337, 475
Eco130I CCWWGG 2 cut(s) 52, 632
Eco47I GGWCC 1 cut(s) 587
Eco57I CTGAAG 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 601
EcoT14I CCWWGG 2 cut(s) 52, 632
ErhI CCWWGG 2 cut(s) 52, 632
FaeI CATG 5 cut(s) 170, 329, 336, 482, 565
FalI AAGNNNNNCTT 1 cut(s) 625
FatI CATG 5 cut(s) 166, 325, 332, 478, 561
FblI GTMKAC 1 cut(s) 143
Fnu4HI GCNGC 1 cut(s) 594
FokI GGATG 1 cut(s) 500
Fsp4HI GCNGC 1 cut(s) 594
FspBI CTAG 1 cut(s) 147
GluI GCNGC 1 cut(s) 594
GsaI CCCAGC 1 cut(s) 295
HaeIII GGCC 1 cut(s) 631
Hin1II CATG 5 cut(s) 170, 329, 336, 482, 565
HphI GGTGA 1 cut(s) 364
Hpy166II GTNNAC 2 cut(s) 144, 550
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 4 cut(s) 167, 326, 485, 539
Hpy8I GTNNAC 2 cut(s) 144, 550
HpyAV CCTTC 1 cut(s) 436
HpyCH4IV ACGT 1 cut(s) 386
HpyF10VI GCNNNNNNNGC 2 cut(s) 292, 525
HpyF3I CTNAG 3 cut(s) 8, 432, 626
HpySE526I ACGT 1 cut(s) 386
Hsp92II CATG 5 cut(s) 170, 329, 336, 482, 565
Kzo9I GATC 5 cut(s) 232, 298, 322, 337, 475
Lsp1109I GCAGC 1 cut(s) 605
MaeI CTAG 1 cut(s) 147
MaeII ACGT 1 cut(s) 386
MaeIII GTNAC 1 cut(s) 194
MalI GATC 5 cut(s) 234, 300, 324, 339, 477
MboI GATC 5 cut(s) 232, 298, 322, 337, 475
MboII GAAGA 3 cut(s) 76, 550, 618
MluCI AATT 4 cut(s) 13, 276, 398, 578
MmeI TCCRAC 3 cut(s) 48, 429, 438
MnlI CCTC 7 cut(s) 27, 292, 322, 364, 530, 621, 639
MroXI GAANNNNTTC 1 cut(s) 501
MslI CAYNNNNRTG 1 cut(s) 566
MspR9I CCNGG 1 cut(s) 603
MvaI CCWGG 1 cut(s) 603
MwoI GCNNNNNNNGC 2 cut(s) 292, 525
NdeII GATC 5 cut(s) 232, 298, 322, 337, 475
NlaIII CATG 5 cut(s) 170, 329, 336, 482, 565
NlaIV GGNNCC 1 cut(s) 59
NspI RCATGY 1 cut(s) 336
PagI TCATGA 2 cut(s) 166, 325
PdmI GAANNNNTTC 1 cut(s) 501
PkrI GCNGC 1 cut(s) 595
Psp6I CCWGG 1 cut(s) 601
PspFI CCCAGC 1 cut(s) 291
PspGI CCWGG 1 cut(s) 601
PspN4I GGNNCC 1 cut(s) 59
PspPI GGNCC 1 cut(s) 587
PsrI GAACNNNNNNTAC 2 cut(s) 465, 497
RsaI GTAC 4 cut(s) 133, 151, 218, 492
RsaNI GTAC 4 cut(s) 132, 150, 217, 491
RseI CAYNNNNRTG 1 cut(s) 566
SatI GCNGC 1 cut(s) 594
Sau3AI GATC 5 cut(s) 232, 298, 322, 337, 475
Sau96I GGNCC 1 cut(s) 587
ScaI AGTACT 2 cut(s) 133, 151
ScrFI CCNGG 1 cut(s) 603
SfcI CTRYAG 1 cut(s) 127
SinI GGWCC 1 cut(s) 587
SmiMI CAYNNNNRTG 1 cut(s) 566
SpeI ACTAGT 1 cut(s) 146
Sse9I AATT 4 cut(s) 13, 276, 398, 578
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 601
StyI CCWWGG 2 cut(s) 52, 632
TaiI ACGT 1 cut(s) 389
TaqII GACCGA 1 cut(s) 575
TasI AATT 4 cut(s) 13, 276, 398, 578
TatI WGTACW 4 cut(s) 131, 149, 216, 490
TseI GCWGC 1 cut(s) 593
TspDTI ATGAA 6 cut(s) 105, 155, 188, 411, 494, 550
VpaK11BI GGWCC 1 cut(s) 587
XapI RAATTY 2 cut(s) 13, 578
XceI RCATGY 1 cut(s) 336
XmiI GTMKAC 1 cut(s) 143
XmnI GAANNNNTTC 1 cut(s) 501
XspI CTAG 1 cut(s) 147
ZrmI AGTACT 2 cut(s) 133, 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.