Rh2DG138800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
11581320 .. 11582365
1046 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG138800.1

Sequence Viewer

Length: 318 bp
ATGACATCGAAACTTCATTCTTATCAGCAGTATCTGCTTGATCATAGATGTAAGACAGGTGTTGACATTGGTCATTTGGCTACTAGGGTTCTGAAGAAACCGATATTGGAGAAAAGCAGCCTGGTGGAGTTGGCTATCGAGCCACTAGCAACGTTAGGGGGAAGTGGATCGTCGACTTCTCAGGAACCGAACTGGGATGCTATAGTTTTCTCAGATGAGGAGATCAAGTATGCAATTTATGATGTCTATACTTCTTATATATGTTATTGGACACAAGCTCTTGGGGATGCTTTAACAAGTTTGTCCACCACATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.66

Weight (kDa)

5.17

Isoelectric Point (pI)

26.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 173
AclI AACGTT 1 cut(s) 152
AclWI GGATC 1 cut(s) 175
AcuI CTGAAG 1 cut(s) 113
AjnI CCWGG 1 cut(s) 120
AjuI GAANNNNNNNTTGG 2 cut(s) 89, 121
AluBI AGCT 1 cut(s) 278
AluI AGCT 1 cut(s) 278
AlwI GGATC 1 cut(s) 175
AlwNI CAGNNNCTG 1 cut(s) 34
ApeKI GCWGC 1 cut(s) 117
BbvI GCAGC 1 cut(s) 129
BciT130I CCWGG 1 cut(s) 122
BclI TGATCA 1 cut(s) 40
BfaI CTAG 2 cut(s) 84, 146
BfmI CTRYAG 1 cut(s) 201
BisI GCNGC 1 cut(s) 118
BlsI GCNGC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 122
BmiI GGNNCC 1 cut(s) 186
BmrFI CCNGG 1 cut(s) 122
BmrI ACTGGG 1 cut(s) 202
BmsI GCATC 2 cut(s) 187, 277
BmuI ACTGGG 1 cut(s) 202
BoxI GACNNNNGTC 1 cut(s) 69
BsaXI ACNNNNNCTCC 2 cut(s) 212, 242
Bse1I ACTGG 1 cut(s) 197
BseBI CCWGG 1 cut(s) 122
BseGI GGATG 2 cut(s) 202, 292
BseMII CTCAG 2 cut(s) 194, 225
BseNI ACTGG 1 cut(s) 197
BseRI GAGGAG 1 cut(s) 233
BseXI GCAGC 1 cut(s) 129
Bsp143I GATC 3 cut(s) 40, 167, 222
BspCNI CTCAG 2 cut(s) 193, 224
BspLI GGNNCC 1 cut(s) 186
BspPI GGATC 1 cut(s) 175
BsrI ACTGG 1 cut(s) 197
BssMI GATC 3 cut(s) 40, 167, 222
Bst2UI CCWGG 1 cut(s) 122
BstAPI GCANNNNNTGC 1 cut(s) 34
BstDEI CTNAG 2 cut(s) 180, 211
BstF5I GGATG 2 cut(s) 202, 292
BstKTI GATC 3 cut(s) 43, 170, 225
BstMBI GATC 3 cut(s) 40, 167, 222
BstMWI GCNNNNNNNGC 1 cut(s) 34
BstNI CCWGG 1 cut(s) 122
BstPAI GACNNNNGTC 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 120
BstSFI CTRYAG 1 cut(s) 201
BstV1I GCAGC 1 cut(s) 129
BtsCI GGATG 2 cut(s) 202, 292
CaiI CAGNNNCTG 1 cut(s) 34
CviJI RGCY 5 cut(s) 80, 120, 134, 142, 278
CviKI_1 RGCY 5 cut(s) 80, 120, 134, 142, 278
DdeI CTNAG 2 cut(s) 180, 211
DpnI GATC 3 cut(s) 42, 169, 224
DpnII GATC 3 cut(s) 40, 167, 222
Eco57I CTGAAG 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 120
FaiI YATR 9 cut(s) 45, 203, 231, 240, 249, 258, 260, 262, 316
FbaI TGATCA 1 cut(s) 40
FblI GTMKAC 1 cut(s) 173
Fnu4HI GCNGC 1 cut(s) 118
FokI GGATG 2 cut(s) 209, 299
Fsp4HI GCNGC 1 cut(s) 118
FspBI CTAG 2 cut(s) 84, 146
GluI GCNGC 1 cut(s) 118
HincII GTYRAC 2 cut(s) 64, 174
HindII GTYRAC 2 cut(s) 64, 174
Hpy166II GTNNAC 3 cut(s) 64, 174, 306
Hpy188I TCNGA 2 cut(s) 93, 214
Hpy188III TCNNGA 1 cut(s) 182
Hpy8I GTNNAC 3 cut(s) 64, 174, 306
Hpy99I CGWCG 1 cut(s) 175
HpyCH4IV ACGT 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpyF3I CTNAG 2 cut(s) 180, 211
HpySE526I ACGT 1 cut(s) 152
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 3 cut(s) 40, 167, 222
LpnPI CCDG 5 cut(s) 42, 107, 134, 167, 178
Lsp1109I GCAGC 1 cut(s) 129
LweI GCATC 2 cut(s) 187, 277
MaeI CTAG 2 cut(s) 84, 146
MaeII ACGT 1 cut(s) 152
MalI GATC 3 cut(s) 42, 169, 224
MboI GATC 3 cut(s) 40, 167, 222
MboII GAAGA 1 cut(s) 106
MluCI AATT 1 cut(s) 234
MnlI CCTC 1 cut(s) 211
MseI TTAA 1 cut(s) 293
MspR9I CCNGG 1 cut(s) 122
MvaI CCWGG 1 cut(s) 122
MwoI GCNNNNNNNGC 1 cut(s) 34
NdeII GATC 3 cut(s) 40, 167, 222
NlaIV GGNNCC 1 cut(s) 186
PkrI GCNGC 1 cut(s) 119
PshAI GACNNNNGTC 1 cut(s) 69
Psp1406I AACGTT 1 cut(s) 152
Psp6I CCWGG 1 cut(s) 120
PspGI CCWGG 1 cut(s) 120
PspN4I GGNNCC 1 cut(s) 186
PstNI CAGNNNCTG 1 cut(s) 34
SalI GTCGAC 1 cut(s) 172
SaqAI TTAA 1 cut(s) 293
SatI GCNGC 1 cut(s) 118
Sau3AI GATC 3 cut(s) 40, 167, 222
ScrFI CCNGG 1 cut(s) 122
SetI ASST 3 cut(s) 61, 155, 280
SfaNI GCATC 2 cut(s) 187, 277
SfcI CTRYAG 1 cut(s) 201
Sse9I AATT 1 cut(s) 234
SspMI CTAG 2 cut(s) 84, 146
StyD4I CCNGG 1 cut(s) 120
TaiI ACGT 1 cut(s) 155
TaqI TCGA 3 cut(s) 8, 138, 173
TasI AATT 1 cut(s) 234
Tru1I TTAA 1 cut(s) 293
Tru9I TTAA 1 cut(s) 293
TseI GCWGC 1 cut(s) 117
TspDTI ATGAA 1 cut(s) 5
XmiI GTMKAC 1 cut(s) 173
XspI CTAG 2 cut(s) 84, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.