Rh3AG309300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0017855
Physical Location & Seq
Forward (+)
38854651 .. 38859600
4950 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG309300.1

Sequence Viewer

Length: 294 bp
ATGGATGCCTCAAGGGAACCTTTGTTGACTACCAAAGTGCCAAGAGTAACTCCCGGGTTTGATAAGAAGTCTAAGAGTGTGAAGGATAATTTGGGGGATGATGGAGTGATTTTGGGGTATAGTGATGAATATTTAAAGAGCAAAGACAAGACCAAGACCGTGAATAATGATGTGGGACCCCTGAAAAGAAAGCCCACGCGTATCCAGAAAACCCTAAAACCCCGTATCCCCTCTCTGGTCTCCCTTCGCTTATCTCTCTCGCAACTCTTCGGATCTAATCGTCTCCTGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.82

Weight (kDa)

10.16

Isoelectric Point (pI)

16.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 199
AclWI GGATC 1 cut(s) 280
AfiI CCNNNNNNNGG 1 cut(s) 235
AflIII ACRYGT 1 cut(s) 197
AjuI GAANNNNNNNTTGG 2 cut(s) 74, 106
Alw26I GTCTC 2 cut(s) 244, 287
AlwI GGATC 1 cut(s) 280
Ama87I CYCGRG 1 cut(s) 53
AspS9I GGNCC 1 cut(s) 176
AsuC2I CCSGG 2 cut(s) 54, 55
AvaI CYCGRG 1 cut(s) 53
AvaII GGWCC 1 cut(s) 176
BccI CCATC 1 cut(s) 95
BciVI GTATCC 2 cut(s) 212, 236
BcnI CCSGG 2 cut(s) 54, 55
BcoDI GTCTC 2 cut(s) 244, 287
BfaI CTAG 1 cut(s) 292
BfuI GTATCC 2 cut(s) 212, 236
Bme1390I CCNGG 2 cut(s) 54, 55
Bme18I GGWCC 1 cut(s) 176
BmeT110I CYCGRG 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 3 cut(s) 18, 177, 178
BmrFI CCNGG 2 cut(s) 54, 55
BpuMI CCSGG 2 cut(s) 54, 55
BsaI GGTCTC 1 cut(s) 244
BsaJI CCNNGG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 235
BseDI CCNNGG 1 cut(s) 53
BseGI GGATG 2 cut(s) 10, 103
BseLI CCNNNNNNNGG 1 cut(s) 235
Bsh1236I CGCG 1 cut(s) 199
BsiHKCI CYCGRG 1 cut(s) 53
BsiSI CCGG 1 cut(s) 54
BslFI GGGAC 1 cut(s) 189
BslI CCNNNNNNNGG 1 cut(s) 235
BsmAI GTCTC 2 cut(s) 244, 287
BsmBI CGTCTC 1 cut(s) 287
BsmFI GGGAC 1 cut(s) 189
Bso31I GGTCTC 1 cut(s) 244
BsoBI CYCGRG 1 cut(s) 53
Bsp143I GATC 2 cut(s) 272, 288
BspFNI CGCG 1 cut(s) 199
BspLI GGNNCC 3 cut(s) 18, 177, 178
BspPI GGATC 1 cut(s) 280
BspTNI GGTCTC 1 cut(s) 244
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 2 cut(s) 272, 288
Bst4CI ACNGT 1 cut(s) 160
Bst6I CTCTTC 1 cut(s) 272
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 2 cut(s) 10, 103
BstFNI CGCG 1 cut(s) 199
BstKTI GATC 2 cut(s) 275, 291
BstMAI GTCTC 2 cut(s) 244, 287
BstMBI GATC 2 cut(s) 272, 288
BstSCI CCNGG 2 cut(s) 52, 53
BstUI CGCG 1 cut(s) 199
BstX2I RGATCY 1 cut(s) 272
BstYI RGATCY 1 cut(s) 272
BsuI GTATCC 2 cut(s) 212, 236
BtsCI GGATG 2 cut(s) 10, 103
Cfr13I GGNCC 1 cut(s) 176
Cfr9I CCCGGG 1 cut(s) 53
CviJI RGCY 1 cut(s) 193
CviKI_1 RGCY 1 cut(s) 193
DdeI CTNAG 1 cut(s) 72
DpnI GATC 2 cut(s) 274, 290
DpnII GATC 2 cut(s) 272, 288
DraI TTTAAA 1 cut(s) 135
Eam1104I CTCTTC 1 cut(s) 272
EarI CTCTTC 1 cut(s) 272
Eco31I GGTCTC 1 cut(s) 244
Eco47I GGWCC 1 cut(s) 176
Eco88I CYCGRG 1 cut(s) 53
EcoO109I RGGNCCY 1 cut(s) 176
Esp3I CGTCTC 1 cut(s) 287
FaiI YATR 1 cut(s) 120
FalI AAGNNNNNCTT 1 cut(s) 36
FaqI GGGAC 1 cut(s) 189
FokI GGATG 2 cut(s) 17, 110
FspBI CTAG 1 cut(s) 292
HapII CCGG 1 cut(s) 54
HincII GTYRAC 1 cut(s) 27
HindII GTYRAC 1 cut(s) 27
HpaII CCGG 1 cut(s) 54
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 1 cut(s) 272
Hpy188III TCNNGA 2 cut(s) 205, 286
Hpy8I GTNNAC 1 cut(s) 27
HpyAV CCTTC 2 cut(s) 76, 254
HpyCH4III ACNGT 1 cut(s) 160
HpyF3I CTNAG 1 cut(s) 72
KflI GGGWCCC 1 cut(s) 176
Kzo9I GATC 2 cut(s) 272, 288
LpnPI CCDG 4 cut(s) 67, 194, 218, 221
MaeI CTAG 1 cut(s) 292
MaeIII GTNAC 1 cut(s) 46
MalI GATC 2 cut(s) 274, 290
MboI GATC 2 cut(s) 272, 288
MboII GAAGA 1 cut(s) 259
MflI RGATCY 1 cut(s) 272
MluCI AATT 1 cut(s) 88
MluI ACGCGT 1 cut(s) 197
MnlI CCTC 2 cut(s) 19, 241
MseI TTAA 1 cut(s) 134
MspI CCGG 1 cut(s) 54
MspR9I CCNGG 2 cut(s) 54, 55
MvnI CGCG 1 cut(s) 199
NciI CCSGG 2 cut(s) 54, 55
NdeII GATC 2 cut(s) 272, 288
NlaIV GGNNCC 3 cut(s) 18, 177, 178
PpuMI RGGWCCY 1 cut(s) 176
Psp5II RGGWCCY 1 cut(s) 176
PspN4I GGNNCC 3 cut(s) 18, 177, 178
PspPI GGNCC 1 cut(s) 176
PspPPI RGGWCCY 1 cut(s) 176
PsuI RGATCY 1 cut(s) 272
SaqAI TTAA 1 cut(s) 134
Sau3AI GATC 2 cut(s) 272, 288
Sau96I GGNCC 1 cut(s) 176
ScrFI CCNGG 2 cut(s) 54, 55
SetI ASST 1 cut(s) 22
SinI GGWCC 1 cut(s) 176
SmaI CCCGGG 1 cut(s) 55
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
Sse9I AATT 1 cut(s) 88
SspI AATATT 1 cut(s) 131
SspMI CTAG 1 cut(s) 292
StyD4I CCNGG 2 cut(s) 52, 53
TaaI ACNGT 1 cut(s) 160
TasI AATT 1 cut(s) 88
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TspDTI ATGAA 1 cut(s) 141
TspMI CCCGGG 1 cut(s) 53
VpaK11BI GGWCC 1 cut(s) 176
XmaI CCCGGG 1 cut(s) 53
XspI CTAG 1 cut(s) 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.