Rh3BG345500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0017855
Physical Location & Seq
Forward (+)
37691778 .. 37692047
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG345500.1

Sequence Viewer

Length: 270 bp
ATGTTGACCCTCAAATTGCCAAGAGTACCTCCAGGGTTTGATAAGAAGTCTAAGGGTGTGAAGGATAATTTGGGGGATGATGGAGTGATTTTAGGGTATAGTGATGAATATTTAAAGAGCAAAGACAAGATCAAAACCGTGAATAATGATGTGGGAGTAAGTGGGTCTAAGCCAAGTGTTGAGGATGTGCAAGAAGAAGTGTCACATCCTTTTCTGCAAGCGGTGTATCAAGAGAAAGCCTTGAGCAAAAAGGAGAAGAAATCCATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.84

Weight (kDa)

8.78

Isoelectric Point (pI)

25.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 221
AfaI GTAC 1 cut(s) 27
AjnI CCWGG 1 cut(s) 31
AjuI GAANNNNNNNTTGG 2 cut(s) 53, 85
BccI CCATC 1 cut(s) 74
BciT130I CCWGG 1 cut(s) 33
Bme1390I CCNGG 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 33
BpmI CTGGAG 1 cut(s) 15
BpuEI CTTGAG 1 cut(s) 262
BsaJI CCNNGG 1 cut(s) 32
BseBI CCWGG 1 cut(s) 33
BseDI CCNNGG 1 cut(s) 32
BseGI GGATG 3 cut(s) 82, 190, 205
Bsp143I GATC 1 cut(s) 129
BspACI CCGC 1 cut(s) 221
BssECI CCNNGG 1 cut(s) 32
BssMI GATC 1 cut(s) 129
Bst2UI CCWGG 1 cut(s) 33
Bst4CI ACNGT 1 cut(s) 139
BstC8I GCNNGC 1 cut(s) 219
BstDEI CTNAG 2 cut(s) 51, 168
BstF5I GGATG 3 cut(s) 82, 190, 205
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BstNI CCWGG 1 cut(s) 33
BstSCI CCNGG 1 cut(s) 31
BtsCI GGATG 3 cut(s) 82, 190, 205
Cac8I GCNNGC 1 cut(s) 219
Csp6I GTAC 1 cut(s) 26
CviAII CATG 1 cut(s) 265
CviJI RGCY 2 cut(s) 172, 239
CviKI_1 RGCY 2 cut(s) 172, 239
CviQI GTAC 1 cut(s) 26
DdeI CTNAG 2 cut(s) 51, 168
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
DraI TTTAAA 1 cut(s) 114
EcoRII CCWGG 1 cut(s) 31
FaeI CATG 1 cut(s) 268
FaiI YATR 2 cut(s) 99, 266
FatI CATG 1 cut(s) 264
FokI GGATG 3 cut(s) 89, 192, 197
GsuI CTGGAG 1 cut(s) 15
Hin1II CATG 1 cut(s) 268
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 6
Hpy188III TCNNGA 1 cut(s) 230
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 55
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4V TGCA 2 cut(s) 190, 217
HpyF3I CTNAG 2 cut(s) 51, 168
Hsp92II CATG 1 cut(s) 268
Kzo9I GATC 1 cut(s) 129
LpnPI CCDG 2 cut(s) 18, 45
MaeIII GTNAC 1 cut(s) 201
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MboII GAAGA 2 cut(s) 206, 268
MluCI AATT 2 cut(s) 14, 67
MnlI CCTC 3 cut(s) 20, 39, 175
MseI TTAA 1 cut(s) 113
MspR9I CCNGG 1 cut(s) 33
MvaI CCWGG 1 cut(s) 33
NdeII GATC 1 cut(s) 129
NlaIII CATG 1 cut(s) 268
NmuCI GTSAC 1 cut(s) 201
Psp6I CCWGG 1 cut(s) 31
PspGI CCWGG 1 cut(s) 31
RsaI GTAC 1 cut(s) 27
RsaNI GTAC 1 cut(s) 26
SaqAI TTAA 1 cut(s) 113
Sau3AI GATC 1 cut(s) 129
ScrFI CCNGG 1 cut(s) 33
SetI ASST 1 cut(s) 31
SmlI CTYRAG 1 cut(s) 241
SmoI CTYRAG 1 cut(s) 241
Sse9I AATT 2 cut(s) 14, 67
SsiI CCGC 1 cut(s) 221
SspI AATATT 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 31
TaaI ACNGT 1 cut(s) 139
TasI AATT 2 cut(s) 14, 67
Tru1I TTAA 1 cut(s) 113
Tru9I TTAA 1 cut(s) 113
TseFI GTSAC 1 cut(s) 201
Tsp45I GTSAC 1 cut(s) 201
TspDTI ATGAA 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.