Rh3BG345400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0017855
Physical Location & Seq
Forward (+)
37690775 .. 37691056
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG345400.1

Sequence Viewer

Length: 282 bp
ATGACCTCAAGAGAAACACATCAAGTGTTAGAGAAACTAGCTGAGAGATCTCAATTATGGGACAATAACCCACAAGGTCGCAAGCCTTCTACCTCACATGTGTCTCTAAAGGAAGCGACTCAACCAAAAACTGGTGGCGTGTATGAAATCAATGCAACAAGCTTGGATGTACATCATGAGTTCAAGAGGTTGGAAGATGGTCTTAACAAGAAGTTTGATATGCTTTTGAAGCAAGGCAAGCAAGGGGTCCGTGAGCAAGTCAATAAGGTTCAAGGGCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.58

Weight (kDa)

9.35

Isoelectric Point (pI)

37.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 131
AfaI GTAC 1 cut(s) 171
AfiI CCNNNNNNNGG 1 cut(s) 131
AflIII ACRYGT 1 cut(s) 97
AgsI TTSAA 3 cut(s) 184, 229, 272
AluBI AGCT 2 cut(s) 41, 162
AluI AGCT 2 cut(s) 41, 162
Alw26I GTCTC 1 cut(s) 108
AoxI GGCC 1 cut(s) 275
AspS9I GGNCC 2 cut(s) 247, 275
AvaII GGWCC 1 cut(s) 247
BccI CCATC 1 cut(s) 191
BcoDI GTCTC 1 cut(s) 108
BfaI CTAG 1 cut(s) 38
BglII AGATCT 1 cut(s) 47
Bme18I GGWCC 1 cut(s) 247
BmgT120I GGNCC 2 cut(s) 247, 275
BmiI GGNNCC 1 cut(s) 248
BsaBI GATNNNNATC 1 cut(s) 171
Bsc4I CCNNNNNNNGG 1 cut(s) 131
Bse1I ACTGG 1 cut(s) 136
Bse8I GATNNNNATC 1 cut(s) 171
BseGI GGATG 1 cut(s) 172
BseJI GATNNNNATC 1 cut(s) 171
BseLI CCNNNNNNNGG 1 cut(s) 131
BseMII CTCAG 1 cut(s) 33
BseNI ACTGG 1 cut(s) 136
BshFI GGCC 1 cut(s) 277
BslFI GGGAC 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 131
BsmAI GTCTC 1 cut(s) 108
BsmFI GGGAC 1 cut(s) 74
BsnI GGCC 1 cut(s) 277
Bsp1407I TGTACA 1 cut(s) 169
Bsp143I GATC 1 cut(s) 47
BspANI GGCC 1 cut(s) 277
BspCNI CTCAG 1 cut(s) 34
BspHI TCATGA 1 cut(s) 175
BspLI GGNNCC 1 cut(s) 248
BsrGI TGTACA 1 cut(s) 169
BsrI ACTGG 1 cut(s) 136
BssMI GATC 1 cut(s) 47
BstAUI TGTACA 1 cut(s) 169
BstC8I GCNNGC 2 cut(s) 83, 239
BstDEI CTNAG 1 cut(s) 42
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 1 cut(s) 50
BstMAI GTCTC 1 cut(s) 108
BstMBI GATC 1 cut(s) 47
BstMWI GCNNNNNNNGC 2 cut(s) 229, 238
BstNSI RCATGY 1 cut(s) 101
BstX2I RGATCY 1 cut(s) 47
BstYI RGATCY 1 cut(s) 47
BsuRI GGCC 1 cut(s) 277
BtsCI GGATG 1 cut(s) 172
Cac8I GCNNGC 2 cut(s) 83, 239
CciI TCATGA 1 cut(s) 175
Cfr13I GGNCC 2 cut(s) 247, 275
Csp6I GTAC 1 cut(s) 170
CviAII CATG 2 cut(s) 98, 176
CviJI RGCY 4 cut(s) 41, 85, 162, 277
CviKI_1 RGCY 4 cut(s) 41, 85, 162, 277
CviQI GTAC 1 cut(s) 170
DdeI CTNAG 1 cut(s) 42
DpnI GATC 1 cut(s) 49
DpnII GATC 1 cut(s) 47
Eco47I GGWCC 1 cut(s) 247
FaeI CATG 2 cut(s) 101, 179
FaiI YATR 6 cut(s) 58, 99, 144, 177, 221, 280
FalI AAGNNNNNCTT 2 cut(s) 186, 218
FaqI GGGAC 1 cut(s) 74
FatI CATG 2 cut(s) 97, 175
FokI GGATG 1 cut(s) 179
FspBI CTAG 1 cut(s) 38
HaeIII GGCC 1 cut(s) 277
Hin1II CATG 2 cut(s) 101, 179
HindIII AAGCTT 1 cut(s) 160
HinfI GANTC 1 cut(s) 118
Hpy188III TCNNGA 3 cut(s) 9, 176, 184
HpyAV CCTTC 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 155
HpyF10VI GCNNNNNNNGC 2 cut(s) 229, 238
HpyF3I CTNAG 1 cut(s) 42
Hsp92II CATG 2 cut(s) 101, 179
Kzo9I GATC 1 cut(s) 47
LpnPI CCDG 1 cut(s) 117
MaeI CTAG 1 cut(s) 38
MalI GATC 1 cut(s) 49
MboI GATC 1 cut(s) 47
MboII GAAGA 1 cut(s) 206
MflI RGATCY 1 cut(s) 47
MluCI AATT 1 cut(s) 53
MlyI GAGTC 1 cut(s) 112
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 3 cut(s) 16, 103, 180
MseI TTAA 1 cut(s) 204
MwoI GCNNNNNNNGC 2 cut(s) 229, 238
NdeII GATC 1 cut(s) 47
NlaIII CATG 2 cut(s) 101, 179
NlaIV GGNNCC 1 cut(s) 248
NspI RCATGY 1 cut(s) 101
PagI TCATGA 1 cut(s) 175
PciI ACATGT 1 cut(s) 97
PflMI CCANNNNNTGG 1 cut(s) 131
PleI GAGTC 1 cut(s) 112
PpsI GAGTC 1 cut(s) 112
PscI ACATGT 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 248
PspPI GGNCC 2 cut(s) 247, 275
PsuI RGATCY 1 cut(s) 47
RsaI GTAC 1 cut(s) 171
RsaNI GTAC 1 cut(s) 170
SaqAI TTAA 1 cut(s) 204
Sau3AI GATC 1 cut(s) 47
Sau96I GGNCC 2 cut(s) 247, 275
SchI GAGTC 1 cut(s) 112
SetI ASST 7 cut(s) 8, 43, 79, 95, 164, 191, 270
SinI GGWCC 1 cut(s) 247
SmlI CTYRAG 1 cut(s) 7
SmoI CTYRAG 1 cut(s) 7
Sse9I AATT 1 cut(s) 53
SspMI CTAG 1 cut(s) 38
TasI AATT 1 cut(s) 53
TatI WGTACW 1 cut(s) 169
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TspDTI ATGAA 1 cut(s) 159
TspGWI ACGGA 1 cut(s) 239
Van91I CCANNNNNTGG 1 cut(s) 131
VpaK11BI GGWCC 1 cut(s) 247
XceI RCATGY 1 cut(s) 101
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.