Rh3AG317500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
43650386 .. 43650536
151 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG317500.1

Sequence Viewer

Length: 151 bp
ATGCTGGGTCTTTTAAGATTTCAAGTATTCATTTTGCCTTCCGAGTTAAAGTTCTTAACAGCTACAGACGTTAATTTCCATTTAGGTCTTGACATATCTTGTGCTGGTTTGCTAGTTTTGGAGGGTTCACAACAACTTGTTCAGCCCTTTG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.53

Weight (kDa)

4.75

Isoelectric Point (pI)

44.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011490)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 23
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
BfaI CTAG 1 cut(s) 113
BfmI CTRYAG 1 cut(s) 63
BseYI CCCAGC 1 cut(s) 4
BstSFI CTRYAG 1 cut(s) 63
CviJI RGCY 2 cut(s) 62, 145
CviKI_1 RGCY 2 cut(s) 62, 145
FaiI YATR 1 cut(s) 95
FspBI CTAG 1 cut(s) 113
FspEI CC 8 cut(s) 51, 55, 69, 90, 92, 104, 107, 108
GsaI CCCAGC 1 cut(s) 8
Hpy166II GTNNAC 1 cut(s) 128
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 1 cut(s) 89
Hpy8I GTNNAC 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 48
HpyCH4IV ACGT 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 69
LpnPI CCDG 1 cut(s) 90
MaeI CTAG 1 cut(s) 113
MaeII ACGT 1 cut(s) 69
MluCI AATT 1 cut(s) 73
MnlI CCTC 1 cut(s) 115
MseI TTAA 4 cut(s) 14, 47, 56, 72
PspFI CCCAGC 1 cut(s) 4
SaqAI TTAA 4 cut(s) 14, 47, 56, 72
SetI ASST 3 cut(s) 64, 72, 88
SfcI CTRYAG 1 cut(s) 63
SgeI CNNG 7 cut(s) 17, 35, 55, 101, 111, 117, 125
Sse9I AATT 1 cut(s) 73
SspMI CTAG 1 cut(s) 113
TaiI ACGT 1 cut(s) 72
TasI AATT 1 cut(s) 73
Tru1I TTAA 4 cut(s) 14, 47, 56, 72
Tru9I TTAA 4 cut(s) 14, 47, 56, 72
TspDTI ATGAA 1 cut(s) 19
XspI CTAG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.