Rh3BG172200

Golgin candidate

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
14704146 .. 14707954
3809 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG172200.1

Sequence Viewer

Length: 516 bp
ATGTGTGTCTTGACTGGCTGTGATTTCCTTCGATCTGTTCCTGGAATTGGGATTGGTAAAGCTTATGCCTTGGTTTCTAAGTATAGGGATCAAATTTCTATATTGAATAAAGAGAATGGCTCATTGAAACAAAATCTGGACACAACTATTGCATCTCTAAATGCCTCTAGAATTGAAAACTACAAAGCGGCAGCAAATGGGACCAACTTGCACAAGGGAAGTAGTAATCAGTCACCCAACCGACAACAAAGATTGACAGGTCATGCAAAAACCAGCTACTCTGGACACCAGAAACAAAATGGTGTTGTCTATACACAAAATGGGAATGGGATAAGCAATGGGATTGCGCATCTTTCAAACATGCAGGGGAATGAAAGGGAGCATCTACAATTCAGTATCATCTCTTTATCAGCATATATTGCAGGATTGGGTTCTCTGGTTTGGAGGTCTAGCGCAAAACACAAGCCCCAAAGAGTTGGAAAGGAGCATCTGCTCGAAGATGAGGATATTGTTTAG

Protein Analysis

171

Amino Acids

18.6

Weight (kDa)

9.55

Isoelectric Point (pI)

25.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 348
AciI CCGC 1 cut(s) 188
AclWI GGATC 1 cut(s) 96
AcsI RAATTY 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 47
AgsI TTSAA 4 cut(s) 106, 127, 176, 357
AjnI CCWGG 1 cut(s) 40
AluBI AGCT 2 cut(s) 62, 276
AluI AGCT 2 cut(s) 62, 276
AlwI GGATC 1 cut(s) 96
ApeKI GCWGC 1 cut(s) 191
ApoI RAATTY 1 cut(s) 93
AspLEI GCGC 2 cut(s) 349, 455
AspS9I GGNCC 1 cut(s) 201
AsuHPI GGTGA 1 cut(s) 225
AvaII GGWCC 1 cut(s) 201
BbvI GCAGC 1 cut(s) 203
BciT130I CCWGG 1 cut(s) 42
BfaI CTAG 2 cut(s) 168, 450
BisI GCNGC 2 cut(s) 189, 192
BlsI GCNGC 2 cut(s) 190, 193
Bme1390I CCNGG 1 cut(s) 42
Bme18I GGWCC 1 cut(s) 201
BmgT120I GGNCC 1 cut(s) 201
BmiI GGNNCC 1 cut(s) 202
BmrFI CCNGG 1 cut(s) 42
BmsI GCATC 4 cut(s) 161, 358, 391, 496
BplI GAGNNNNNCTC 2 cut(s) 104, 136
BsaJI CCNNGG 1 cut(s) 69
Bsc4I CCNNNNNNNGG 1 cut(s) 47
Bse1I ACTGG 1 cut(s) 19
Bse3DI GCAATG 1 cut(s) 343
BseBI CCWGG 1 cut(s) 42
BseDI CCNNGG 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 47
BseMI GCAATG 1 cut(s) 343
BseNI ACTGG 1 cut(s) 19
BseXI GCAGC 1 cut(s) 203
BslFI GGGAC 1 cut(s) 214
BslI CCNNNNNNNGG 1 cut(s) 47
BsmFI GGGAC 1 cut(s) 214
Bsp143I GATC 2 cut(s) 32, 88
BspACI CCGC 1 cut(s) 188
BspLI GGNNCC 1 cut(s) 202
BspPI GGATC 1 cut(s) 96
BsrDI GCAATG 1 cut(s) 343
BsrI ACTGG 1 cut(s) 19
BssECI CCNNGG 1 cut(s) 69
BssMI GATC 2 cut(s) 32, 88
BssT1I CCWWGG 1 cut(s) 69
Bst2UI CCWGG 1 cut(s) 42
BstAPI GCANNNNNTGC 1 cut(s) 419
BstDEI CTNAG 1 cut(s) 78
BstHHI GCGC 2 cut(s) 349, 455
BstKTI GATC 2 cut(s) 35, 91
BstMBI GATC 2 cut(s) 32, 88
BstMWI GCNNNNNNNGC 1 cut(s) 419
BstNI CCWGG 1 cut(s) 42
BstNSI RCATGY 1 cut(s) 364
BstSCI CCNGG 1 cut(s) 40
BstV1I GCAGC 1 cut(s) 203
BstXI CCANNNNNNTGG 1 cut(s) 476
CfoI GCGC 2 cut(s) 349, 455
Cfr13I GGNCC 1 cut(s) 201
CviAII CATG 2 cut(s) 263, 361
CviJI RGCY 5 cut(s) 18, 62, 120, 276, 466
CviKI_1 RGCY 5 cut(s) 18, 62, 120, 276, 466
DdeI CTNAG 1 cut(s) 78
DpnI GATC 2 cut(s) 34, 90
DpnII GATC 2 cut(s) 32, 88
Eco130I CCWWGG 1 cut(s) 69
Eco47I GGWCC 1 cut(s) 201
EcoRII CCWGG 1 cut(s) 40
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
FaeI CATG 2 cut(s) 266, 364
FaiI YATR 8 cut(s) 66, 84, 101, 264, 312, 362, 415, 417
FaqI GGGAC 1 cut(s) 214
FatI CATG 2 cut(s) 262, 360
Fnu4HI GCNGC 2 cut(s) 189, 192
Fsp4HI GCNGC 2 cut(s) 189, 192
FspBI CTAG 2 cut(s) 168, 450
FspI TGCGCA 1 cut(s) 348
GlaI GCGC 2 cut(s) 348, 454
GluI GCNGC 2 cut(s) 189, 192
HhaI GCGC 2 cut(s) 349, 455
Hin1II CATG 2 cut(s) 266, 364
Hin6I GCGC 2 cut(s) 347, 453
HinP1I GCGC 2 cut(s) 347, 453
HindIII AAGCTT 1 cut(s) 60
HphI GGTGA 1 cut(s) 225
Hpy188III TCNNGA 4 cut(s) 10, 137, 168, 282
HpyAV CCTTC 1 cut(s) 38
HpyCH4V TGCA 5 cut(s) 152, 211, 266, 364, 422
HpyF10VI GCNNNNNNNGC 1 cut(s) 419
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 2 cut(s) 266, 364
HspAI GCGC 2 cut(s) 347, 453
Kzo9I GATC 2 cut(s) 32, 88
LmnI GCTCC 2 cut(s) 379, 484
Lsp1109I GCAGC 1 cut(s) 203
LweI GCATC 4 cut(s) 161, 358, 391, 496
MaeI CTAG 2 cut(s) 168, 450
MaeIII GTNAC 1 cut(s) 231
MalI GATC 2 cut(s) 34, 90
MboI GATC 2 cut(s) 32, 88
MboII GAAGA 1 cut(s) 509
MluCI AATT 4 cut(s) 45, 93, 171, 389
MmeI TCCRAC 1 cut(s) 457
MnlI CCTC 3 cut(s) 175, 438, 496
MspR9I CCNGG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 42
MwoI GCNNNNNNNGC 1 cut(s) 419
NdeII GATC 2 cut(s) 32, 88
NlaIII CATG 2 cut(s) 266, 364
NlaIV GGNNCC 1 cut(s) 202
NmuCI GTSAC 1 cut(s) 231
NsbI TGCGCA 1 cut(s) 348
NspI RCATGY 1 cut(s) 364
PfoI TCCNGGA 1 cut(s) 40
PkrI GCNGC 2 cut(s) 190, 193
Psp6I CCWGG 1 cut(s) 40
PspGI CCWGG 1 cut(s) 40
PspN4I GGNNCC 1 cut(s) 202
PspPI GGNCC 1 cut(s) 201
SatI GCNGC 2 cut(s) 189, 192
Sau3AI GATC 2 cut(s) 32, 88
Sau96I GGNCC 1 cut(s) 201
ScrFI CCNGG 1 cut(s) 42
SetI ASST 4 cut(s) 64, 262, 278, 449
SfaNI GCATC 4 cut(s) 161, 358, 391, 496
SinI GGWCC 1 cut(s) 201
Sse9I AATT 4 cut(s) 45, 93, 171, 389
SsiI CCGC 1 cut(s) 188
SspMI CTAG 2 cut(s) 168, 450
StyD4I CCNGG 1 cut(s) 40
StyI CCWWGG 1 cut(s) 69
TaqI TCGA 2 cut(s) 31, 495
TasI AATT 4 cut(s) 45, 93, 171, 389
TauI GCSGC 1 cut(s) 191
TseFI GTSAC 1 cut(s) 231
TseI GCWGC 1 cut(s) 191
Tsp45I GTSAC 1 cut(s) 231
TspDTI ATGAA 1 cut(s) 387
VpaK11BI GGWCC 1 cut(s) 201
XapI RAATTY 1 cut(s) 93
XbaI TCTAGA 1 cut(s) 167
XceI RCATGY 1 cut(s) 364
XcmI CCANNNNNNNNNTGG 1 cut(s) 296
XspI CTAG 2 cut(s) 168, 450
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.